Cart 1 Product Products 121,50 € (empty)
-
1 x PHB-prohib...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
View larger 
Data sheet of IGF1R-insulin-like growth factor 1 receptor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IGF1R-insulin-like growth factor 1 receptor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010607 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IGF1R |
| Origin species: | Human |
| Product name: | IGF1R-insulin-like growth factor 1 receptor Gene |
| Size: | 2ug |
| Accessions: | BC010607 |
| Gene id: | 3480 |
| Gene description: | insulin-like growth factor 1 receptor |
| Synonyms: | soluble IGF1R variant 2; soluble IGF1R variant 1; CD221; IGFIR; IGFR; JTK13; insulin-like growth factor 1 receptor; IGF-I receptor; insulin like growth factor 1 receptor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaacagccgaggtgttggagcccagcagtgcatggcaccgttcggcatctggcttgattggtctggctgccgtcattgtcagcacagtgccatggacatgggaagacttgactgcacagccaatggttttcatgatgattacagcatacacagtgatcacataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vesicle-associated membrane protein 4 - vesicle-associated membrane protein 4 - secretory carrier membrane protein 1 - acetyl-Coenzyme A acetyltransferase 1 |