ARHGAP19-Rho GTPase activating protein 19 Gene View larger

ARHGAP19-Rho GTPase activating protein 19 Gene

PTXBC007848

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARHGAP19-Rho GTPase activating protein 19 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARHGAP19-Rho GTPase activating protein 19 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007848
Product type: DNA & cDNA
Ncbi symbol: ARHGAP19
Origin species: Human
Product name: ARHGAP19-Rho GTPase activating protein 19 Gene
Size: 2ug
Accessions: BC007848
Gene id: 84986
Gene description: Rho GTPase activating protein 19
Synonyms: rho GTPase-activating protein 19; rho-type GTPase-activating protein 19; Rho GTPase activating protein 19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatagacttttgcattgggaccaatgaatctggtgtgaaaaaccctgctgtagtagtgaaagagcatcaggagatactgactgtacctgagggccaaaacaggagcaggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - abhydrolase domain containing 12B
- coiled-coil domain containing 115
- damage-regulated autophagy modulator
- hypothetical protein MGC34034

Reviews

Buy ARHGAP19-Rho GTPase activating protein 19 Gene now

Add to cart