Cart 45 Product Products 7 171,55 € (empty)
-
1 x C10orf97-c...121,50 € -
1 x Ameloblast...259,07 € -
-
1 x HERPUD1-ho...121,50 € -
1 x OLAH-oleoy...113,40 € -
1 x HDHD2-halo...113,40 € -
1 x GGTA1-glyc...113,40 € -
-
1 x CRB3-crumb...113,40 € -
1 x HDHD1A-hal...113,40 € -
-
-
1 x PPIE-pepti...121,50 € -
1 x USP25-ubiq...121,50 € -
-
1 x SERPINE2-s...121,50 € -
1 x PTPRCAP-pr...113,40 € -
-
-
-
1 x Cleaved-La...259,07 € -
-
-
-
1 x SERPINB4-s...121,50 € -
1 x CCNG1-cycl...121,50 € -
1 x GEFT-RhoA/...121,50 € -
1 x FADD-Fas...113,40 € -
1 x ANKRD39-an...113,40 € -
1 x ANG-angiog...113,40 € -
1 x HSL...259,07 € -
-
-
-
1 x IRF2-inter...121,50 € -
1 x SERPINF1-s...121,50 € -
1 x ATG9B-ATG9...121,50 € -
-
-
1 x GIF-gastri...121,50 € -
1 x OAZ3-ornit...113,40 € -
1 x OR5P2-olfa...121,50 € -
-
1 x REG1B-rege...113,40 € -
No products
To be determined Shipping
7 171,55 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 45 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 171,55 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 171,55 €
Data sheet of PRKCH-protein kinase C, eta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRKCH-protein kinase C, eta Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC037268 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRKCH |
| Origin species: | Human |
| Product name: | PRKCH-protein kinase C, eta Gene |
| Size: | 2ug |
| Accessions: | BC037268 |
| Gene id: | 5583 |
| Gene description: | protein kinase C, eta |
| Synonyms: | PKC-L; PKCL; PRKCL; nPKC-eta; protein kinase C eta type; protein kinase C eta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgtctggcaccatgaagttcaatggctatttgagggtccgcatcggtgaggcagtggggctgcagcccacccgctggtccctgcgccactcgctcttcaagaagggccaccagctgctggacccctatctgacggtgagcgtggaccaggtgcgcgtgggccagaccagcaccaagcagaagaccaacaaacccacgtacaacgaggagttttgcgctaacgtcaccgacggcggccacctcgagttggccgtcttccacgagacgcccctgggctacgaccacttcgtggccaactgcaccctgcagttccaggagctgctgcgcacgaccggcgcctcggacaccttcgagggttgggtggatctcgagccagaggggaaagtattcgtggtaataacccttaccgggagtttcactgaagctactctccagagagaccggatcttcaaacattttaccaggaagcgccaaagggctatgcgaaggcgagtccaccagatcaatggacacaagttcatggccacgtatctgaggcagcccacctactgctctcactgcagggagtttatctggggagtgtttgggaaacagggttatcagtgccaagtgtgcacctgtgtcgtccataaacgctgccatcatctaattgttacagcctgtacttgccaaaacaatattaacaaagtggattcaaagattgcagaacagaggttcgggatcaacatcccacacaagttcagcatccacaactacaaagtgccaacattctgcgatcactgtggctcactgctctggggaataatgcgacaaggacttcagtgtaaaatatgtaaaatgaatgtgcatattcgatgtcaagcgaacgtggcccctaactgtggggtaaatgcggtggaacttgccaagaccctggcagggatgggtctccaacccggaaatatttctccaacctcgaaactcgtttccagatcgaccctaagacgacagggaaaggagagcagcaaagaaggaaatgggattggggttaattcttccaaccgacttggtatcgacaactttgagttcatccgagtgttggggaaggggagttttgggaaggtgatgcttgcaagagtaaaagaaacaggagacctctatgctgtgaaggtgctgaagaaggacgtgattctgcaggatgatgatgtggaatgcaccatgaccgagaaaaggatcctgtctctggcccgcaatcaccccttcctcactcagttgttctgctgctttcagacccccgatcgtctgttttttgtgatggagtttgtgaatgggggtgacttgatgttccacattcagaagtctcgtcgttttgatgaagcacgagctcgcttctatgctgcagaaatcatttcggctctcatgttcctccatgataaaggaatcatctatagagatctgaaactggacaatgtcctgttggaccacgagggtcactgtaaactggcagacttcggaatgtgcaaggaggggatttgcaatggtgtcaccacggccacattctgtggcacgccagactatatcgctccagagatcctccaggaaatgctgtacgggcctgcagtagactggtgggcaatgggcgtgttgctctatgagatgctctgtggtcacgcgccttttgaggcagagaatgaagatgacctctttgaggccatactgaatgatgaggtggtctaccctacctggctccatgaagatgccacagggatcctaaaatctttcatgaccaagaaccccaccatgcgcttgggcagcctgactcagggaggcgagcacgccatcttgagacatcctttttttaaggaaatcgactgggcccagctgaaccatcgccaaatagaaccgcctttcagacccagaatcaaatcccgagaagatgtcagtaattttgaccctgacttcataaaggaagagccagttttaactccaattgatgagggacatcttccaatgattaaccaggatgagtttagaaacttttcctatgtgtctccagaattgcaaccatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SFRS protein kinase 2 - ribosomal protein S29 - PHD finger protein 5A - ribosomal protein L35 |