Cart 27 Product Products 5 378,15 € (empty)
-
-
-
1 x hCG_181173...113,40 € -
1 x CCNI2-cycl...121,50 € -
1 x CCDC54-coi...121,50 € -
1 x HBD-hemogl...113,40 € -
1 x MKRN3-mako...113,40 € -
-
-
1 x UGCG-UDP-g...121,50 € -
1 x GEMIN7-gem...113,40 € -
1 x TMEM53-tra...121,50 € -
1 x HAT1-histo...121,50 € -
-
-
1 x C14orf100-...121,50 € -
1 x CCDC115-co...113,40 € -
1 x IL17F-inte...113,40 € -
-
-
1 x SERINC1-se...121,50 € -
1 x LDHA-lacta...121,50 € -
1 x ZNF69-zinc...113,40 € -
1 x ROPN1B-rop...113,40 € -
1 x SERPINA3-s...121,50 € -
-
No products
To be determined Shipping
5 378,15 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 27 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 378,15 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 378,15 €
View larger 
VPS18-vacuolar protein sorting 18 homolog (S. cerevisiae) Gene
PTXBC001513
New product
Data sheet of VPS18-vacuolar protein sorting 18 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VPS18-vacuolar protein sorting 18 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC001513 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VPS18 |
| Origin species: | Human |
| Product name: | VPS18-vacuolar protein sorting 18 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC001513 |
| Gene id: | 57617 |
| Gene description: | vacuolar protein sorting 18 homolog (S. cerevisiae) |
| Synonyms: | VPS18, CORVET/HOPS core subunit; PEP3; vacuolar protein sorting-associated protein 18 homolog; hVPS18; vacuolar protein sorting 18 homolog; vacuolar protein sorting protein 18 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtccatcctggatgagtacgagaactcgctgtcccgctcggccgtcttgcagcccggctgccctagcgtgggcatcccccactcggggtatgtgaatgcccagctggagaaggaagtgcccatcttcacaaagcagcgcattgacttcaccccttccgagcgcattaccagtcttgtcgtctccagcaatcagctgtgcatgagcctgggcaaggatacactgctccgcattgacttgggcaaggcaaatgagcccaaccacgtggagctgggacgtaaggatgacgcaaaagttcacaagatgttccttgaccatactggctctcacctgctgattgccctgagcagcacggaggtcctctacgtgaaccgaaatggacagaaggtacggccactagcacgctggaaggggcagctggtggagagtgtgggttggaacaaggcactgggcacggagagcagcacaggccccatcctggtcgggactgcccaaggccacatctttgaagcagagctctcagccagcgaaggtgggcttttcggccctgctccggatctctacttccgcccattgtacgtgctaaatgaagaagggggtccagcacctgtgtgctcccttgaggccgagcggggccctgatgggcgtagctttgttattgccaccactcggcagcgcctcttccagttcataggccgagcagcagagggggctgaggcccagggtttctcagggctctttgcagcttacacggaccacccacccccattccgtgagtttcccagcaacctgggctacagtgagttggccttctacacccccaagctgcgctccgcaccccgggccttcgcctggatgatgggggatggtgtgttgtatggggcattggactgtgggcgccctgactctctgctgagcgaggagcgagtctgggagtacccagagggggtagggcctggggccagcccacccctagccatcgtcttgacccagttccacttcctgctgctactggcagaccgggtggaggcagtgtgcacactgaccgggcaggtggtgctgcgggatcacttcctggagaaatttgggccgctgaagcacatggtgaaggactcctccacaggccagctgtgggcctacactgagcgggctgtcttccgctaccacgtgcaacgggaggcccgagatgtctggcgcacctatctggacatgaaccgcttcgatctggccaaagagtattgtcgagagcggcccgactgcctggacacggtcctggcccgggaggccgatttctgctttcgccagcgtcgctacctggagagcgcacgctgctatgccctgacccagagctactttgaggagattgccctcaagttcctggaggcccgacaggaggaggctctggctgagttcctgcagcgaaaactggccagtttgaagccagccgaacgtacccaggccacactgctgaccacctggctgacagagctctacctgagccggcttggggctctgcagggcgacccagaggccctgactctctaccgagaagtcagaaatctgacccaattccaccccctgcctctagcacctcttctgtccctgtcattccccacacacgtcctgttcacctcgagagagagagagagagagcacctttcttccgtctgttcactctgcggcctctggaatcccagctcttctctctcagaagaagccttctcttcctcctgcctgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vesicle-associated membrane protein 3 (cellubrevin) - vesicle-associated membrane protein 3 (cellubrevin) - integrin beta 3 binding protein (beta3-endonexin) - v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog |