Cart 2 Product Products 228,64 € (empty)
-
-
1 x IGF2-insul...113,40 €
No products
To be determined Shipping
228,64 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 228,64 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 228,64 €
View larger 
SLC25A23-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 23 Gene
PTXBC001656
New product
Data sheet of SLC25A23-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 23 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A23-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 23 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001656 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A23 |
| Origin species: | Human |
| Product name: | SLC25A23-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 23 Gene |
| Size: | 2ug |
| Accessions: | BC001656 |
| Gene id: | 79085 |
| Gene description: | solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 |
| Synonyms: | APC2; MCSC2; SCaMC-3; calcium-binding mitochondrial carrier protein SCaMC-3; mitochondrial ATP-Mg/Pi carrier protein 2; mitochondrial Ca(2+)-dependent solute carrier protein 2; mitochondrial Ca2+-dependent solute carrier protein 2; short calcium-binding mitochondrial carrier 3; small calcium-binding mitochondrial carrier protein 3; solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23; solute carrier family 25 member 23 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgggggagcccgggcgacgcggagcggcggcagcgctggggtcgcctgttcgaggagctggacagtaacaaggatggccgcgtggacgtgcacgagttgcgccaggggctggccaggctgggcgggggcaacccagaccccggcgcccaacagggtatctcctctgagggtgatgctgacccagatggcgggctcgacctggaggaattttcccgctatctgcaggagcgggaacagcgtctgctgctcatgtttcacagtcttgaccggaaccaggatggtcacattgatgtctctgagatccaacagagtttccgagctctgggcatttccatctcgctggagcaggctgagaaaattttgcacagcatggaccgagacggcacaatgaccattgactggcaagaatggcgcgaccacttcctgttgcattcgctggaaaatgtggaggacgtgctgtatttctggaagcattccacgctctcttctgctgggttctctgcctggataaaagattctacggctgaacagaatcgttcaaaaaccacggtcttggccaggcgcagtggctcacacctgaaatcccagcactttgggaggccgaagtgggcggatcacgaggtcctggacattggcgagtgcctgacagtgccggacgagttctcaaagcaagagaagctgacgggcatgtggtggaaacagctggtggccggcgcagtggcaggtgccgtgtcacggacaggcacggcccctctggaccgcctcaaggtcttcatgcaggtccatgcctcaaagaccaaccggctgaacatccttggggggcttcgaagcatggtccttgagggaggcatccgctccctgtggcgcggcaatggtattaatgtactcaagattgcccccgagtcagctatcaagttcatggcctatgaacagatcaagagggccatcctggggcagcaggagacactgcatgtgcaggagcgcttcgtggctggctccctggctggtgccacagcccaaaccatcatttaccctatggaggtgctgaagacgcggctgaccttgcgccggacgggccagtataaggggctgctggactgcgccaggcgtatcctggagagggaggggccccgtgccttctaccgcggctacctccccaacgtgctgggcatcatcccctatgcgggcatcgacctggccgtctacgagactctgaagaactggtggcttcagcagtacagccacgactcggcagacccaggcatcctcgtgctcctggcctgcggtaccatatccagcacctgcggccagatagccagttacccgctggccctggtccggacccgcatgcaggcacaaggctggagtacagtggctcgatttcagatcactgcaacctctgccttccaggttcaagcgattctcctgcctcagcctccagagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) - solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 - solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 - solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 |