Cart 5 Product Products 582,81 € (empty)
-
1 x ISG20L2-in...121,50 € -
-
-
1 x NPTN-neuro...121,50 € -
1 x LIPA-lipas...121,50 €
No products
To be determined Shipping
582,81 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 582,81 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 582,81 €
View larger 
Data sheet of MPP1-membrane protein, palmitoylated 1, 55kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MPP1-membrane protein, palmitoylated 1, 55kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002392 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MPP1 |
| Origin species: | Human |
| Product name: | MPP1-membrane protein, palmitoylated 1, 55kDa Gene |
| Size: | 2ug |
| Accessions: | BC002392 |
| Gene id: | 4354 |
| Gene description: | membrane protein, palmitoylated 1, 55kDa |
| Synonyms: | AAG12; DXS552E; EMP55; MRG1; PEMP; 55 kDa erythrocyte membrane protein; aging-associated gene 12; erythrocyte membrane protein p55; membrane protein, palmitoylated 1; membrane protein, palmitoylated 1, 55kDa; migration-related gene 1; p55; palmitoylated erythrocyte membrane protein; membrane palmitoylated protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccctcaaggcgagcgagggcgagagtgggggcagcatgcacacggcgctctccgacctctacctggagcatttgctgcagaagcgtagtcggccagaggctgtatcgcatccattgaatactgtgaccgaggacatgtacaccaacgggtctcctgccccaggtagccctgcccaggtcaagggacaggaggtgcggaaagtgcgactcatacagtttgagaaggtcacagaagagcccatgggaatcacgctgaagctgaatgaaaaacagtcctgtacggtggccagaattcttcatggtggcatgatccatagacaaggctcccttcacgtgggggatgagatcctagaaatcaatggcacaaatgtgacaaatcattcagtggatcagctgcagaaggcgatgaaagaaaccaaaggaatgatctcattaaaagtaattcccaaccagcaaagccgtcttcctgcactacagatgttcatgagagcgcagtttgactatgatcccaaaaaggacaatctgatcccttgcaaggaggcgggactgaagtttgctactggggacattatccagattatcaacaaggatgacagcaattggtggcagggacgggtggaaggctcctccaaggagtcagcaggattgatcccttcccctgagctgcaggaatggcgagtggcaagtatggctcagtcagctcctagcgaagccccgagctgcagtccctttgggaagaagaagaagtacaaagacaaatatctggccaagcacagctcgatttttgatcagttggatgttgtttcctacgaggaagtcgttcggctccctgcattcaagaggaagaccctggtgctgatcggagccagtggggtgggtcgcagccacattaagaatgccctgctcagccagaatccggagaagtttgtgtaccctgtcccatatacaacacggccgccaaggaagagtgaggaagatgggaaggagtaccactttatctcaacggaggagatgacgaggaacatctctgccaatgagttcttggagtttggcagctaccaaggcaacatgtttggcaccaaatttgaaacagtgcaccagatccataagcagaacaagattgccatccttgacattgagccccagaccctgaaaattgttcggacagcagaactttcgcctttcattgtgttcattgcacctactgaccagggcactcagacagaagccctgcagcagctgcagaaggactctgaggccatccgcagccagtacgctcactactttgacctctcactggtcaataatggtgttgatgaaacccttaagaaattacaagaagccttcgaccaagcgtgcagttctccacagtgggtgcctgtctcctgggtttactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - megakaryocyte-associated tyrosine kinase - thyroid hormone receptor interactor 10 - glutamate receptor, ionotropic, delta 1 - SEC24 family, member A (S. cerevisiae) |