Cart 61 Product Products 7 836,22 € (empty)
-
1 x NXPH3-neur...113,40 € -
1 x ILF3-inter...113,40 € -
1 x GNPTAB-N-a...113,40 € -
1 x WDR73-WD...121,50 € -
1 x CENPM-cent...113,40 € -
-
-
1 x SEPSECS-Se...121,50 € -
-
1 x CBWD1-COBW...121,50 € -
1 x WISP3-WNT1...113,40 € -
-
1 x GOLGA8G-go...121,50 € -
-
1 x ACYP2...259,07 € -
-
-
-
1 x NBL1-neuro...113,40 € -
1 x OR8B8-olfa...121,50 € -
-
-
1 x FUT9-fucos...121,50 € -
1 x ITLN1-inte...121,50 € -
-
1 x DCUN1D4-DC...113,40 € -
1 x ASB6-ankyr...121,50 € -
1 x NT5C-5',...113,40 € -
1 x CHRNB3-cho...121,50 € -
1 x SCN2B-sodi...113,40 € -
1 x CLDN10-cla...113,40 € -
1 x NEUROD6-ne...121,50 € -
1 x CHRNA5-cho...121,50 € -
1 x POMP-prote...113,40 € -
1 x PATE-expre...113,40 € -
-
-
-
1 x CXXC4-CXXC...113,40 € -
1 x Neuro D...259,07 € -
-
-
-
1 x DYNC2LI1-d...113,40 € -
-
-
-
1 x LigaTrap...284,64 € -
1 x TRAM1L1-tr...121,50 € -
1 x RP5-1022P6...113,40 € -
-
-
1 x ACOT7-acyl...121,50 € -
1 x APOH-apoli...121,50 € -
1 x APOC3-apol...113,40 € -
-
-
1 x CTSL2-cath...121,50 € -
-
-
No products
To be determined Shipping
7 836,22 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 61 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 836,22 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 836,22 €
Data sheet of KIAA0409-KIAA0409 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIAA0409-KIAA0409 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001071 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIAA0409 |
| Origin species: | Human |
| Product name: | KIAA0409-KIAA0409 Gene |
| Size: | 2ug |
| Accessions: | BC001071 |
| Gene id: | 23378 |
| Gene description: | KIAA0409 |
| Synonyms: | KIAA0409; NML; ribosomal RNA-processing protein 8; RRP8 methyltransferase homolog; cerebral protein 1; nucleomethylin; ribosomal RNA processing 8, methyltransferase, homolog (yeast) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcgaagagcctgagtgggccgaggcggccccagtagccgcgggccttgggcccgtaatctcacgacctccgcctgcggcctcctcgcaaaacaagggctccaagcgccgccagctcttggccacattacgggccctagaggcagcatctctttcccagcatccccccagcctatgtataagtgactctgaggaggaggaggaggaaaggaagaagaaatgccccaaaaaggcatcatttgccagtgcctctgctgaagtagggaagaaagggaagaagaaatgtcaaaaacagggcccaccttgcagtgactctgaggaagaagtagaaaggaagaagaaatgccacaaacaggctcttgttggcagtgactctgctgaagatgagaaaagaaagaggaaatgccagaaacatgcccctataaattcagcccagcacctggacaatgttgaccaaacaggtcccaaagcctggaagggtagtactacaaatgatccaccaaagcaaagccctgggtccacttcccctaaaccccctcatacattaagccgcaagcagtggcggaaccggcaaaagaataagagaagatgtaagaacaagtttcagccacctcaggtgccagaccaggccccagctgaggcccccacagagaagacagaggtgtctcctgttcccaggacagacagccatgaggctcgggcaggggctttgcgagcccgcatggcacagcggctggatggggcccgatttcgctacctcaatgaacagttgtactcagggcccagcagtgctgcacagcgtctcttccaggaagaccctgaggcttttcttctctaccaccgcggcttccagagccaagtgaagaagtggccactgcagccagtggaccgcatcgccagggatcttcgccagcggcctgcatccctagtggtggctgacttcggctgtggggattgccgcttggcttcaagtatccggaaccctgtgcattgctttgacttggcttctctggaccctagggtcactgtgtgtgacatggcccaggttcctctggaggatgagtctgtggatgtggctgtgttttgcctttcactgatgggaaccaacatcagggacttcctagaggaggcaaatagagtactgaagccagggggtctcctgaaagtggctgaggtcagcagccgctttgaggatgttcgaacctttctgcgggctgtgaccaagctaggcttcaagattgtctccaaggacctgaccaacagccatttcttcttgtttgatttccaaaagactgggccccctctggtagggcccaaggctcagctttcaggcctgcagcttcagccatgtctctacaagcgcaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - KIAA1279 - transketolase - neuropilin 1 - contactin 4 |