Cart 1 Product Products 113,40 € (empty)
-
1 x NDUFS3-NAD...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
COPS2-COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) Gene
PTXBC012629
New product
Data sheet of COPS2-COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COPS2-COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012629 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COPS2 |
| Origin species: | Human |
| Product name: | COPS2-COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) Gene |
| Size: | 2ug |
| Accessions: | BC012629 |
| Gene id: | 9318 |
| Gene description: | COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) |
| Synonyms: | ALIEN; CSN2; SGN2; TRIP15; COP9 signalosome complex subunit 2; COP9 constitutive photomorphogenic homolog subunit 2; JAB1-containing signalosome subunit 2; TR-interacting protein 15; TRIP-15; alien homolog; signalosome subunit 2; thyroid receptor-interacting protein 15; COP9 signalosome subunit 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgacatggaggatgatttcatgtgcgatgatgaggaggactacgacctggaatactctgaagatagtaactccgagccaaatgtggatttggaaaatcagtactataattccaaagcattaaaagaagatgacccaaaagcggcattaagcagtttccaaaaggttttggaacttgaaggtgaaaaaggagaatggggatttaaagcactgaaacaaatgattaagattaacttcaagttgacaaactttccagaaatgatgaatagatataagcagctattgacctatattcggagtgcagtcacaagaaattattctgaaaaatccattaattctattcttgattatatctctacttctaaacagatggatttactgcaggaattctatgaaacaacactggaagctttgaaagatgctaagaatgatagactgtggtttaagacaaacacaaagcttggaaaattatatttagaacgagaggaatatggaaagcttcaaaaaattttacgccagttacatcagtcgtgccagactgatgatggagaagatgatctgaaaaaaggtacacagttattagaaatatatgctttggaaattcaaatgtacacagcacagaaaaataacaaaaaacttaaagcactctatgaacagtcacttcacatcaagtctgccatccctcatccactgattatgggagttatcagagaatgtggtggtaaaatgcacttgagggaaggtgaatttgaaaaggcacacactgatttttttgaagccttcaagaattatgatgaatctggaagtccaagacgaaccacttgcttaaaatatttggtcttagcaaatatgcttatgaaatcgggaataaatccatttgactcacaggaggccaagccgtacaaaaatgatccagaaattttagcaatgacgaatttagtaagtgcctatcagaataatgacatcactgaatttgaaaagattctaaaaacaaatcacagcaacatcatggatgatcctttcataagagaacacattgaagagcttttgcgaaacatcagaacacaagtgcttataaaattaattaagccttacacaagaatacatattccttttatttctaaggagttaaacatagatgtagctgatgtggagagcttgctggtgcagtgcatattggataacactattcatggccgaattgatcaagtcaaccaactccttgaactggatcatcagaagaggggtggtgcacgatatactgcactagataaatggaccaaccaactaaattctctcaaccaggctgtagtcagtaaactggcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B - ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit - hepatoma-derived growth factor (high-mobility group protein 1-like) - Src homology 3 domain-containing guanine nucleotide exchange factor |