Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of AP2M1-adaptor-related protein complex 2, mu 1 subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AP2M1-adaptor-related protein complex 2, mu 1 subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013796 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AP2M1 |
| Origin species: | Human |
| Product name: | AP2M1-adaptor-related protein complex 2, mu 1 subunit Gene |
| Size: | 2ug |
| Accessions: | BC013796 |
| Gene id: | 1173 |
| Gene description: | adaptor-related protein complex 2, mu 1 subunit |
| Synonyms: | AP50; CLAPM1; mu2; AP-2 complex subunit mu; AP-2 mu 2 chain; HA2 50 kDA subunit; adaptin-mu2; adaptor protein complex AP-2 subunit mu; adaptor-related protein complex 2 subunit mu; clathrin adaptor complex AP2, mu subunit; clathrin assembly protein complex 2 medium chain; clathrin assembly protein complex 2 mu medium chain; clathrin coat adaptor protein AP50; clathrin coat assembly protein AP50; clathrin coat-associated protein AP50; clathrin-associated/assembly/adaptor protein, medium 1; plasma membrane adaptor AP-2 50 kDa protein; plasma membrane adaptor AP-2 50kDA protein; adaptor related protein complex 2 mu 1 subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattggaggcttattcatctataatcacaagggggaggtgctcatctcccgagtctaccgagatgacatcgggaggaacgcagtggatgcctttcgggtcaatgttatccatgcccggcagcaggtgcgcagccccgtcaccaacattgctcgcaccagcttcttccacgttaagcggtccaacatttggctggcagcagtcaccaagcagaatgtcaacgctgccatggtcttcgaattcctctataagatgtgtgacgtgatggctgcctactttggcaagatcagcgaggaaaacatcaagaacaattttgtgctcatatatgagctgctggatgagattctagactttggctacccacagaattccgagacaggcgcgctgaaaaccttcatcacgcagcagggcatcaagagtcagacaaaagaagagcagtcacagatcaccagccaggtaactgggcagattggctggcggcgagagggtatcaagtatcgtcggaatgagctcttcctggatgtgctggagagtgtgaacctgctcatgtccccacaagggcaggtgctgagtgcccatgtgtcgggccgggtggtgatgaagagctacctgagtggcatgcctgaatgcaagtttgggatgaatgacaagattgttattgaaaagcagggcaaaggcacagctgatgaaacaagcaagagcgggaagcaatcaattgccattgatgactgcaccttccaccagtgtgtgcgactcagcaagtttgactctgaacgcagcatcagctttatcccgccagatggagagtttgagcttatgaggtatcgcacaaccaaggacatcatccttcccttccgggtgatcccgctagtgcgagaagtgggacgcaccaaactggaggtcaaggtggtcatcaagtccaactttaaaccctcactgctggctcagaagattgaggtgaggatcccaaccccactgaacacaagcggggtgcaggtgatctgcatgaaggggaaggccaagtacaaggccagcgagaatgccatcgtgtggaagatcaagcgcatggcaggcatgaaggaatcgcagatcagcgcagagattgagcttctgcctaccaacgacaagaagaaatgggctcgaccccccatttccatgaactttgaggtgccattcgcaccctctggcctcaaggtgcgctacttgaaggtgtttgaaccgaagctgaactacagcgaccatgatgtcatcaaatgggtgcgctacattggccgcagtggcatttatgaaactcgctgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - caspase 2, apoptosis-related cysteine peptidase - CDK5 regulatory subunit associated protein 1 - eukaryotic translation initiation factor 2C, 2 - family with sequence similarity 116, member A |