Cart 5 Product Products 1 514,75 € (empty)
-
-
1 x ANKHD1-ank...121,50 € -
1 x ABI2-abl...121,50 € -
-
No products
To be determined Shipping
1 514,75 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 514,75 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 514,75 €
View larger 
IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene
PTXBC011899
New product
Data sheet of IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011899 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IFT57 |
| Origin species: | Human |
| Product name: | IFT57-intraflagellar transport 57 homolog (Chlamydomonas) Gene |
| Size: | 2ug |
| Accessions: | BC011899 |
| Gene id: | 55081 |
| Gene description: | intraflagellar transport 57 homolog (Chlamydomonas) |
| Synonyms: | ESRRBL1; HIPPI; MHS4R2; intraflagellar transport protein 57 homolog; HIP1 protein interactor; HIP1-interacting protein; dermal papilla-derived protein 8; estrogen-related receptor beta like 1; estrogen-related receptor beta-like protein 1; huntingtin interacting protein-1 interacting protein; intraflagellar transport 57 homolog; intraflagellar transport 57 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactgctgctctggccgtcgtcacgacgtcgggtttggaagatggggtgcctaggtcccgtggcgaagggaccggggaagtggtcttggagcgggggcccggcgcggcctaccacatgttcgtggtgatggaggacttggtggagaagctgaagctgctccgctacgaggaggagttcctccggaagagcaacctgaaggccccgtccagacactattttgcactgcctaccaaccctggcgaacagttctacatgttttgtactcttgctgcttggttgattaataaagcgggacgtccctttgagcagcctcaagaatatgatgaccctaatgcaacaatatctaacatactatccgagcttcggtcatttggaagaactgcagattttcctccttcaaaattaaagtcaggttatggagaacatgtatgctatgttcttgattgcttcgctgaagaagcattgaaatatattggtttcacctggaaaaggccaatatacccagtagaagaattagaagaagaaagcgttgcagaagatgatgcagaattaacattaaataaagtggatgaagaatttgtggaagaagagacagataatgaagaaaactttattgatctcaacgttttaaaggcccagacatatcacttggatatgaacgagactgccaaacaagaagatattttggaatccacaacagatgctgcagaatggagcctagaagtggaacgtgtactaccgcaactgaaagtcacgattaggactgacaataaggattggagaatccatgttgaccaaatgcaccagcacagaagtggaattgaatctgctctaaaggagaccaagggatttttggacaaactccataatgaaattactaggactttggaaaagatcagcagccgagaaaagtacatcaacaatcagcttgagaatttggttcaagaatatcgtgcagctcaagcccagctgagtgaggcaaaggagcgataccagcagggaaatggaggagtgacggaaagaaccagactcctctctgaggttatggaagaattagaaaaggtaaaacaagaaatggaagaaaagggcagcagcatgactgatggtgctcctttggtgaagattaaacagagcttaacaaaactgaagcaagaaactgtagagatggacattagaattggcattgtggaacacacactactccaatcaaagctgaaggagaagtccaacatgactaggaacatgcatgccacagttattccagaaccagcaacaggcttttattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - G protein regulated inducer of neurite outgrowth 2 - eukaryotic translation elongation factor 1 alpha 2 - ribosomal protein S6 kinase, 90kDa, polypeptide 5 - vacuolar protein sorting 18 homolog (S. cerevisiae) |