Cart 2 Product Products 1 138,00 € (empty)
-
1 x TNF-beta494,00 € -
1 x Trefoil...644,00 €
No products
To be determined Shipping
1 138,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 138,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 138,00 €
Data sheet of MRPL37-mitochondrial ribosomal protein L37 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL37-mitochondrial ribosomal protein L37 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000041 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL37 |
| Origin species: | Human |
| Product name: | MRPL37-mitochondrial ribosomal protein L37 Gene |
| Size: | 2ug |
| Accessions: | BC000041 |
| Gene id: | 51253 |
| Gene description: | mitochondrial ribosomal protein L37 |
| Synonyms: | L2mt; L37mt; MRP-L2; MRP-L37; MRPL2; RPML2; 39S ribosomal protein L37, mitochondrial; 39S ribosomal protein L2, mitochondrial; ribosomal protein, mitochondrial, L2; mitochondrial ribosomal protein L37 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcattggcgtccgggcccgcaaggcgggcgctagctggctccgggcagctcggccttgggggcttcggggccccgagacgcggggcgtatgagtggggcgtgcgctccacgcgtaagtcggagcctcctcccctggatagggtgtacgagatccctggactggagcccatcacctttgcggggaagatgcacttcgtgccctggctggcgcggccgatctttccgccctgggaccgcggctacaaggacccaaggttctaccgctcgccccctcttcacgagcatccgctgtacaaagaccaggcctgctatatctttcaccaccgttgccgccttctcgagggtgtaaagcaggccctctggctcaccaagaccaagttaatagaaggccttcccgagaaagtgcttagccttgttgatgatccaaggaaccacatagagaaccaagacgagtgcgttctgaatgtgatctctcacgcccgtctctggcagaccactgaggaaatccccaagagagagacctactgcccggtcatcgtggacaacctaatacagctgtgtaaatctcagattctcaagcatccttctctggccaggaggatctgtgtccaaaactccacgttttctgctacctggaaccgagagtctcttctccttcaagtccgtggttctggtggagcccgactgagcactaaggatcctctgcccaccatcgcctccagagaggagattgaagctactaagaatcatgttctagagaccttctaccccatatcacccatcatcgatcttcatgaatgcaatatttatgatgtgaaaaatgacacaggattccaggaaggctatccttacccctatccccataccctgtacttactggacaaagccaatttacgaccacaccgccttcaaccagatcagctgcgggccaagatgatcctgtttgcttttggcagtgccctggctcaggcccggctcctctatgggaatgatgccaaggtcttggagcagcccgtggtggtgcagagcgtgggcacggatggacgtgtcttccatttcctagtgtttcaactgaataccacagacctggactgtaacgagggtgtcaagaatttggcctgggtggactcagaccagctcctctatcagcatttttggtgtctcccagtgatcaaaaagagagtggttgtggaacctgttgggccagttggtttcaagccagagacattcagaaagtttttagctctatatttgcatggtgctgcgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein arginine methyltransferase 2 - zinc finger, SWIM-type containing 1 - IKAROS family zinc finger 2 (Helios) - solute carrier family 41, member 3 |