Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SERPINB2-serpin peptidase inhibitor, clade B (ovalbumin), member 2 Gene
PTXBC012609
New product
Data sheet of SERPINB2-serpin peptidase inhibitor, clade B (ovalbumin), member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPINB2-serpin peptidase inhibitor, clade B (ovalbumin), member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012609 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINB2 |
| Origin species: | Human |
| Product name: | SERPINB2-serpin peptidase inhibitor, clade B (ovalbumin), member 2 Gene |
| Size: | 2ug |
| Accessions: | BC012609 |
| Gene id: | 5055 |
| Gene description: | serpin peptidase inhibitor, clade B (ovalbumin), member 2 |
| Synonyms: | HsT1201; PAI; PAI-2; PAI2; PLANH2; plasminogen activator inhibitor 2; monocyte Arg-serpin; placental plasminogen activator inhibitor; plasminogen activator inhibitor, type II (arginine-serpin); serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2; serpin B2; serpin peptidase inhibitor, clade B (ovalbumin), member 2; urokinase inhibitor; serpin family B member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggatctttgtgtggcaaacacactctttgccctcaatttattcaagcatctggcaaaagcaagccccacccagaacctcttcctctccccatggagcatctcgtccaccatggccatggtctacatgggctccaggggcagcaccgaagaccagatggccaaggtgcttcagtttaatgaagtgggagccaatgcagttacccccatgactccagagaactttaccagctgtgggttcatgcagcagatccagaagggtagttatcctgatgcgattttgcaggcacaagctgcagataaaatccattcatccttccgctctctcagctctgcaatcaatgcatccacagggaattatttactggaaagtgtcaataagctgtttggtgagaagtctgcgagcttccgggaagaatatattcgactctgtcagaaatattactcctcagaaccccaggcagtagacttcctagaatgtgcagaagaagctagaaaaaagatttattcctgggtcaagactcaaaccaaaggcaaaatcccaaacttgttacctgaaggttctgtagatggggataccaggatggtcctggtgaatgctgtctacttcaaaggaaagtggaaaactccatttgagaagaaactaaatgggctttatcctttccgtgtaaactcggctcagcgcacacctgtacagatgatgtacttgcgtgaaaagctaaacattggatacatagaagacctaaaggctcagattctagaactcccatatgctggagatgttagcatgttcttgttgcttccagatgaaattgccgatgtgtccactggcttggagctgctggaaagtgaaataacctatgacaaactcaacaagtggaccagcaaagacaaaatggctgaagatgaagttgaggtatacataccccagttcaaattagaagagcattatgaactcagatccattctgagaagcatgggcatggaggacgccttcaacaagggacgggccaatttctcagggatgtcggagaggaatgacctgtttctttctgaagtgttccaccaagccatggtggatgtgaatgaggagggcactgaagcagccgctggcacaggaggtgttatgacagggagaactggacatggaggcccacagtttgtggcagatcatccttttctttttcttattatgcataagataaccaactgcattttatttttcggcagattttcctcaccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polymerase (DNA directed), delta 2, regulatory subunit 50kDa - SHC (Src homology 2 domain containing) transforming protein 3 - LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa |