Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ELK3-ELK3, ETS-domain protein (SRF accessory protein 2) Gene
PTXBC017371
New product
Data sheet of ELK3-ELK3, ETS-domain protein (SRF accessory protein 2) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ELK3-ELK3, ETS-domain protein (SRF accessory protein 2) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017371 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ELK3 |
| Origin species: | Human |
| Product name: | ELK3-ELK3, ETS-domain protein (SRF accessory protein 2) Gene |
| Size: | 2ug |
| Accessions: | BC017371 |
| Gene id: | 2004 |
| Gene description: | ELK3, ETS-domain protein (SRF accessory protein 2) |
| Synonyms: | ELK3, ETS transcription factor; ELK3, ETS-domain protein (SRF accessory protein 2); ERP; NET; SAP-2; SAP2; ETS domain-containing protein Elk-3; ETS-related protein ERP; ETS-related protein NET; SRF accessory protein 2; serum response factor accessory protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagagtgcaatcacgctgtggcagttcctgttgcagttgctgctggatcagaaacatgagcatttgatctgctggacctcgaacgatggtgaattcaagctcctcaaagcagaagaagtggccaagctgtggggactccgaaaaaacaaaacaaatatgaactatgataagctgagcagagccctgcgatactattatgacaagaacatcatcaagaaggtgatcgggcagaagtttgtgtacaagtttgtctctttcccggagatcctgaagatggatcctcacgcggtggagatcagccgggagagccttctgctgcaggacagcgactgcaaggcgtctccggagggccgcgaggcccacaaacacggcctggccgccctcagaagcacgagccgcaacgaatacatccactcaggcctgtactcgtccttcaccattaattccctgcagaacccaccagacgccttcaaggccatcaagacggagaagctggaggagccgcccgaagacagcccccccgtggaagaagtcaggactgtgatcaggtttgtgaccaataaaaccgacaagcacgtcaccaggccggtggtgtccctgccttccacgtcagaggctgcggcggcgtccgccttcctggcctcgtccgtctcggccaagatctcctctttaatgttgccaaacgctgccagtatttcatccgcctcacccttctcatctcggtccccgtccctgtcccccaactcacccctcccttctgaacacagaagcctcttcctggaggccgcctgccatgactccgattccctggagcccttgaacctgtcatcgggctccaagaccaagtctccatctcttcccccaaaggccaaaaaacccaaaggcttggaaatctcagcgcccccgctggtgctctccggcaccgacatcggctccatcgccctcaacagcccagccctcccctcgggatccctcaccccagccttcttcaccgcacagacaccaaatggattgcttctgactccgagtccactgctctccagcatacatttctggagcagccttagtccagttgctccgctgagtcctgccaggctgcaagggccaagcacgctgttccagttccccacactgcttaatggccacatgccagtgccaatccccagtctggacagagctgcttctccagtactgctttcttcaaactctcagaaatcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ectonucleoside triphosphate diphosphohydrolase 3 - ubiquinol-cytochrome c reductase core protein II - PRP4 pre-mRNA processing factor 4 homolog (yeast) - family with sequence similarity 130, member A1 |