Cart 39 Product Products 4 593,78 € (empty)
-
1 x C11orf67-c...113,40 € -
1 x MDP-1-magn...113,40 € -
1 x PTS-6-pyru...113,40 € -
1 x PARP6-poly...121,50 € -
-
1 x LST1-leuko...113,40 € -
1 x BEX5-brain...113,40 € -
-
-
1 x FTL-ferrit...113,40 € -
1 x SPATA3-spe...113,40 € -
1 x C16orf65-c...113,40 € -
1 x TRIM31-tri...113,40 € -
1 x EIF3E-euka...121,50 € -
1 x WBP2NL-WBP...113,40 € -
1 x KIR2DL1-ki...121,50 € -
1 x NDUFB1-NAD...113,40 € -
-
1 x C19orf34-c...113,40 € -
-
1 x TCN2-trans...121,50 € -
1 x NECAP1-NEC...113,40 € -
1 x IL21-inter...113,40 € -
-
1 x PRKAG2-pro...121,50 € -
1 x GABRA2-gam...121,50 € -
1 x NDRG1-N-my...113,40 € -
1 x XCL2-chemo...113,40 € -
1 x TMSB4X-thy...113,40 € -
-
-
1 x PRDX3-pero...113,40 € -
1 x SMNDC1-sur...113,40 € -
1 x DBNL-drebr...121,50 € -
1 x FBXO46-F-b...121,50 € -
1 x ASB9-ankyr...121,50 € -
1 x Goat...225,00 € -
-
No products
To be determined Shipping
4 593,78 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 39 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 593,78 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 593,78 €
View larger 
B4GALT3-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 Gene
PTXBC000276
New product
Data sheet of B4GALT3-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about B4GALT3-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000276 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | B4GALT3 |
| Origin species: | Human |
| Product name: | B4GALT3-UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 Gene |
| Size: | 2ug |
| Accessions: | BC000276 |
| Gene id: | 8703 |
| Gene description: | UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 |
| Synonyms: | beta4Gal-T3; beta-1,4-galactosyltransferase 3; UDP-Gal:beta-GlcNAc beta-1,4-galactosyltransferase 3; UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3; UDP-galactose:beta-N-acetylglucosamine beta-1,4-galactosyltransferase 3; b4Gal-T3; beta-1,4-GalTase 3; beta-N-acetylglucosaminyl-glycolipid beta-1,4-galactosyltransferase 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgcggaggctgctggagcggccttgcacgctggccctgcttgtgggctcccagctggctgtcatgatgtacctgtcactggggggcttccgaagtctcagtgccctatttggccgagatcagggaccgacatttgactattctcaccctcgtgatgtctacagtaacctcagtcacctgcctggggccccagggggtcctccagctcctcaaggtctgccctactgtccagaacgatctcctctcttagtgggtcctgtgtcagtgtcctttagcccagtgccatcactggcagagattgtggagcggaatccccgggtagaaccagggggccggtaccgccctgcaggttgtgagccccgctcccgaacagccatcattgtgcctcatcgtgcccgggagcaccacctgcgcctgctgctctaccacctgcaccccttcttgcagcgccagcagcttgcttatggcatctatgtcatccaccaggctggaaatggaacatttaacagggcaaaactgttgaatgttggggtgcgagaggccctgcgtgatgaagagtgggactgcctgttcttgcacgatgtggacctcttgccagaaaatgaccacaatctgtatgtgtgtgacccccggggaccccgccatgttgccgttgctatgaacaagtttggatacagcctcccgtacccccagtacttcggaggagtctcagcacttactcctgaccagtacctgaagatgaatggcttccccaatgaatactggggctggggtggtgaggatgacgacattgctaccagggtgcgcctggctgggatgaagatctctcggccccccacatctgtaggacactataagatggtgaagcaccgaggagataagggcaatgaggaaaatccccacagatttgacctcctggtccgtacccagaattcctggacgcaagatgggatgaactcactgacataccagttgctggctcgagagctggggcctctttataccaacatcacagcagacattgggactgaccctcggggtcctcgggctccttctgggccacgttacccacctggttcctcccaagccttccgtcaagagatgctgcaacgccggcccccagccaggcctgggcctctatctactgccaaccacacagccctccgaggttcacactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) - nuclear fragile X mental retardation protein interacting protein 1 - small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta - melanoma antigen family A, 1 (directs expression of antigen MZ2-E) |