Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNJ15-potassium inwardly-rectifying channel, subfamily J, member 15 Gene
PTXBC013327
New product
Data sheet of KCNJ15-potassium inwardly-rectifying channel, subfamily J, member 15 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNJ15-potassium inwardly-rectifying channel, subfamily J, member 15 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013327 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNJ15 |
| Origin species: | Human |
| Product name: | KCNJ15-potassium inwardly-rectifying channel, subfamily J, member 15 Gene |
| Size: | 2ug |
| Accessions: | BC013327 |
| Gene id: | 3772 |
| Gene description: | potassium inwardly-rectifying channel, subfamily J, member 15 |
| Synonyms: | IRKK; KIR1.3; KIR4.2; ATP-sensitive inward rectifier potassium channel 15; inward rectifier K(+) channel Kir1.3; inward rectifier K(+) channel Kir4.2; inward rectifier K+ channel KIR4.2; potassium channel, inwardly rectifying subfamily J member 15; potassium inwardly-rectifying channel, subfamily J, member 15; potassium voltage-gated channel subfamily J member 15 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgccattcacatcggcatgtccagcacccccctggtgaagcacactgctggggctgggctcaaggccaacagaccccgcgtcatgtccaagagtgggcacagcaacgtgagaattgacaaagtggatggcatatacctactctacctgcaagacctgtggaccacagttatcgacatgaagtggagatacaaactcaccctgttcgctgccacttttgtgatgacctggttcctttttggagtcatctactatgccatcgcgtttattcatggggacttagaacccggtgagcccatttcaaatcataccccctgcatcatgaaagtggactctctcactggggcgtttctcttttccctggaatcccagacaaccattggctatggagtccgttccatcacagaggaatgtcctcatgccatcttcctgttggttgctcagttggtcatcacgaccttgattgagatcttcatcaccggaaccttcctggccaaaatcgccagacccaaaaagcgggctgagaccatcaagttcagccactgtgcagtcatcaccaagcagaatgggaagctgtgcttggtgattcaggtagccaatatgaggaagagcctcttgattcagtgccagctctctggcaagctcctgcagacccacgtcaccaaggagggggagcggattctcctcaaccaagccactgtcaaattccacgtggactcctcctctgagagccccttcctcattctgcccatgacattctaccatgtgctggatgagacgagccccctgagagacctcacaccccaaaacctaaaggagaaggagtttgagcttgtggtcctcctcaatgccactgtggaatccaccagcgctgtctgccagagccgaacatcttatatcccagaggaaatctactggggttttgagtttgtgcctgtggtatctctctccaaaaatggaaaatatgtggctgatttcagtcagtttgaacagattcggaaaagcccagattgcacattttactgtgcagattctgagaaacagcaactcgaggagaagtacaggcaggaggatcagagggaaagagaactgaggacacttttattacaacagagcaatgtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - KRR1, small subunit (SSU) processome component, homolog (yeast) - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 - transcobalamin I (vitamin B12 binding protein, R binder family) - solute carrier family 23 (nucleobase transporters), member 2 |