Cart 40 Product Products 5 349,56 € (empty)
-
-
1 x C6orf168-c...121,50 € -
1 x FAM122C-fa...113,40 € -
1 x MR1-major...121,50 € -
-
1 x FLJ34048-h...113,40 € -
1 x MPHOSPH6-M...113,40 € -
1 x SYP-synapt...121,50 € -
1 x FAM151B-fa...121,50 € -
-
1 x SLC48A1-so...113,40 € -
1 x MRPL44-mit...121,50 € -
1 x PSMB7-prot...121,50 € -
1 x LINCR-like...113,40 € -
-
-
1 x PTPN7-prot...121,50 € -
1 x NAPRT1-nic...121,50 € -
1 x C2orf56-ch...113,40 € -
1 x PPIL1-pept...113,40 € -
1 x DUSP13-dua...113,40 € -
1 x C17orf89-c...113,40 € -
1 x LRRN4CL-LR...113,40 € -
1 x INPP1-inos...121,50 € -
1 x NRBF2-nucl...121,50 € -
1 x KLRAQ1-KLR...121,50 € -
-
-
-
1 x HLA-DQB2-m...113,40 € -
1 x GPR119-G...121,50 € -
-
1 x MITD1-MIT,...113,40 € -
-
1 x ATP5H-ATP...113,40 € -
1 x C16orf70-c...121,50 € -
1 x COX6B2-cyt...113,40 € -
-
-
-
1 x FAM122C-fa...113,40 €
No products
To be determined Shipping
5 349,56 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 40 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 349,56 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 349,56 €
Data sheet of ZNF385B-zinc finger protein 385B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZNF385B-zinc finger protein 385B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC038422 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZNF385B |
| Origin species: | Human |
| Product name: | ZNF385B-zinc finger protein 385B Gene |
| Size: | 2ug |
| Accessions: | BC038422 |
| Gene id: | 151126 |
| Gene description: | zinc finger protein 385B |
| Synonyms: | ZNF533; zinc finger protein 385B; zinc finger protein 533 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgcagccttcactggatatcaaaccatttatgtcttttccagtggacagtagttctgctgttgggctctttccaaattttaacacaatggatcctgtgcaaaaagcggttattaaccatacatttggagtatccattcccccaaagaagaaacaagttatttcttgtaatgtctgtcagcttcgctttaactcagatagccaggccgaggcccactacaaaggaagtaaacatgccaagaaggtcaaagcactagacgcaacgaaaaataaacccaaaatggttccttccaaggacagcgcaaaggctaatcccagctgctccatcactccaatcacaggcaacaactctgacaaatcagaagataaagggaagttaaaagccagcagttccagtcagccatcaagctctgaaagtggctcatttctcctcaaatctggcacaacacccctgccacctggagcagccacttctccctccaagagcacaaatggagctcccggtactgttgttgaatcagaagaagaaaaagccaaaaaattactttattgttcactatgcaaagtggctgtgaactccctgtcacagctagaggcacacaacacaggatctaaacacaagaccatggttgaagctcgtaatggggctggtccaattaaatcctatcctagacctggatcaagattaaagatgcagaatggcagtaaggggtcaggactacagaacaagacatttcattgtgaaatctgtgatgttcatgttaattcagaaattcaactcaaacagcacatttctagccgaaggcataaagatcgagttgcagggaaaccactgaagccaaaatacagcccttacaacaaactccagcggagcccgagtattctagcagcaaaacttgcattccagaaagatatgatgaagcctttggccccagccttcctgtcctcacctctcgcagcggcggcagccgtgtcctcagcgctgtcactcccaccccggccctctgcctcgctcttccaggctccagccattcctccagctcttctgaggcctgggcatgggcccatccgcgccactcctgcctccatcctctttgctccgtactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GDP-mannose 4,6-dehydratase - kelch domain containing 3 - kelch domain containing 2 - endothelin receptor type A |