Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene
PTXBC011676
New product
Data sheet of NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011676 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NFKBIE |
| Origin species: | Human |
| Product name: | NFKBIE-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon Gene |
| Size: | 2ug |
| Accessions: | BC011676 |
| Gene id: | 4794 |
| Gene description: | nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon |
| Synonyms: | IKBE; NF-kappa-B inhibitor epsilon; I-kappa-B-epsilon; NF-kappa-BIE; ikB-E; ikB-epsilon; ikappaBepsilon; nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon; NFKB inhibitor epsilon |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggaggcgcggaaggggccggacgaggcggaggagagccagtacgactctggcattgagtctctgcgctctctgcgctccctacccgagtccacctcggctccagcctccgggccctcggacggcagcccccagccctgcacccatcctccgggacccgtcaaggaaccacaggagaaggaagacgcggatggggagcgggctgattccacctatggctcctcctcgctcacctacaccctgtccttgctggggggccccgaggctgaggacccggccccacgcctgccactcccccacgtgggggcgctgagccctcagcagctggaagcactcacttacatctccgaggacggagacacgctggtccacctggcagtgattcatgaggccccagcggtgctgctctgttgcctggctttgctgccccaggaggtcctggacattcaaaataacctttaccagacagcactccatctggctgtacatctggaccaaccgggcgcagttcgggcactggtgctgaagggggccagccgggcactacaggaccggcatggtgacacagcccttcatgtggcctgccagcgccagcacttggcctgtgcccgctgcctgctggaagggcggccagagccaggcagaggaacatctcactctctggacctccagctgcaaaactggcaaggtctggcttgtctccacattgccacccttcagaagaaccaaccactcatggaattgctgcttcggaatggagctgacattgatgtgcaggagggcaccagtggtaagacagcgctgcacctggctgtggaaacccaagagcggggcctggtacagttcctgctccaggctggtgcccaggtagatgcccgcatgctgaacgggtgcacacccctgcacctggcagctggccggggtctcatgggcatctcatccactctgtgcaaggcgggtgctgactccctgctgcggaatgtggaggatgagacgccccaggacctgactgaggaatcccttgtccttttgccctttgatgacctgaagatctcagggaaactgctgctgtgtaccgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 - eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) - regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1 - regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2 |