Cart 37 Product Products 5 056,68 € (empty)
-
1 x HFM1-HFM1,...121,50 € -
1 x DAZ3-delet...121,50 € -
-
1 x SERINC3-se...121,50 € -
1 x SERPINB1-s...121,50 € -
-
1 x SERBP1-SER...121,50 € -
1 x PSMG3-prot...113,40 € -
1 x CCM2-cereb...113,40 € -
1 x ZDHHC20-zi...113,40 € -
-
-
-
-
1 x SERPINB11-...121,50 € -
1 x KRT8-kerat...121,50 € -
-
-
1 x ZNF673-zin...113,40 € -
1 x CCNB1IP1-c...121,50 € -
1 x IFT20-intr...113,40 € -
1 x MAGEC3-mel...121,50 € -
1 x HP-haptogl...121,50 € -
1 x Donkey...223,00 € -
1 x OLA1-Obg-l...121,50 € -
1 x hCG_173187...113,40 € -
1 x IFI30-inte...113,40 € -
1 x NAT1-N-ace...121,50 € -
1 x IFT81-intr...113,40 € -
1 x EDA-ectody...121,50 € -
1 x OAZ1-ornit...113,40 € -
1 x APOBEC4...259,07 € -
-
-
1 x LOC26010-v...121,50 € -
1 x RAB17-RAB1...113,40 € -
No products
To be determined Shipping
5 056,68 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 37 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 056,68 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 056,68 €
Data sheet of EFNB1-ephrin-B1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EFNB1-ephrin-B1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016649 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EFNB1 |
| Origin species: | Human |
| Product name: | EFNB1-ephrin-B1 Gene |
| Size: | 2ug |
| Accessions: | BC016649 |
| Gene id: | 1947 |
| Gene description: | ephrin-B1 |
| Synonyms: | CFND; CFNS; EFB1; EFL3; EPLG2; Elk-L; LERK2; ephrin-B1; ELK ligand; eph-related receptor tyrosine kinase ligand 2; ephrin B1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcggcctgggcagcgttggctcggcaagtggcttgtggcgatggtcgtgtgggcgctgtgccggctcgccacaccgctggccaagaacctggagcccgtatcctggagctccctcaaccccaagttcctgagtgggaagggcttggtgatctatccgaaaattggagacaagctggacatcatctgcccccgagcagaagcagggcggccctatgagtactacaagctgtacctggtgcggcctgagcaggcagctgcctgtagcacagttctcgaccccaacgtgttggtcacctgcaataggccagagcaggaaatacgctttaccatcaagttccaggagttcagccccaactacatgggcctggagttcaagaagcaccatgattactacattacctcaacatccaatggaagcctggaggggctggaaaaccgggagggcggtgtgtgccgcacacgcaccatgaagatcatcatgaaggttgggcaagatcccaatgctgtgacgcctgagcagctgactaccagcaggcccagcaaggaggcagacaacactgtcaagatggccacacaggcccctggtagtcggggctccctgggtgactctgatggcaagcatgagactgtgaaccaggaagagaagagtggcccaggtgcaagtgggggcagcagcggggaccctgatggcttcttcaactccaaggtggcattgttcgcggctgtcggtgccggttgcgtcatcttcctgctcatcatcatcttcctgacggtcctactactgaagctacgcaagcggcaccgcaagcacacacagcagcgggcggctgccctctcgctcagtaccctggccagtcccaaggggggcagtggcacagcgggcaccgagcccagcgacatcatcattcccttacggactacagagaacaactactgcccccactatgagaaggtgagtggggactacgggcaccctgtctacatcgtccaagagatgccgccccagagcccggcgaacatctactacaaggtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin - surfeit 6 - NAD kinase - sestrin 2 |