Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KIR2DL3-killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 Gene
PTXBC032422
New product
Data sheet of KIR2DL3-killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIR2DL3-killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032422 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIR2DL3 |
| Origin species: | Human |
| Product name: | KIR2DL3-killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 Gene |
| Size: | 2ug |
| Accessions: | BC032422 |
| Gene id: | 3804 |
| Gene description: | killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 |
| Synonyms: | natural killer cell inhibitory receptor KIR2DL3; CD158B2; CD158b; GL183; KIR-023GB; KIR-K7b; KIR-K7c; KIR2DS5; KIRCL23; NKAT; NKAT2; NKAT2A; NKAT2B; p58; killer cell immunoglobulin-like receptor 2DL3; CD158 antigen-like family member B2; NKAT-2; killer cell immunoglobulin-like receptor two domains long cytoplasmic tail 3; killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5; killer inhibitory receptor cl 2-3; natural killer associated transcript 2; p58 NK receptor CL-6; p58 natural killer cell receptor clone CL-6; p58.2 MHC class-I specific NK receptor; killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgctcatggtcgtcagcatggtgtgtgttgggttcttcttgctgcagggggcctggccacatgagggagtccacagaaaaccttccctcctggcccacccaggtcccctggtgaaatcagaagagacagtcatcctgcaatgttggtcagatgtcaggtttcagcacttccttctgcacagagaagggaagtttaaggacactttgcacctcattggagagcaccatgatggggtctccaaggccaacttctccatcggtcccatgatgcaagaccttgcagggacctacagatgctacggttctgttactcactccccctatcagttgtcagctcccagtgaccctctggacatcgtcatcacaggtctatatgagaaaccttctctctcagcccagccgggccccacggttctggcaggagagagcgtgaccttgtcctgcagctcccggagctcctatgacatgtaccatctatccagggagggggaggcccatgaacgtaggttctctgcagggcccaaggtcaacggaacattccaggccgactttcctctgggccctgccacccacggaggaacctacagatgcttcggctctttccgtgactctccatacgagtggtcaaactcgagtgacccactgcttgtttctgtcacaggaaacccttcaaatagttggctttcacccactgaaccaagctccgaaaccggtaaccccagacacctgcatgttctgattgggacctcagtggtcatcatcctcttcatcctcctcctcttctttctccttcatcgctggtgctgcaacaaaaaaaatgctgttgtaatggaccaagagcctgcagggaacagaacagtgaacagggaggactctgatgaacaagaccctcaggaggtgacatatgcacagttgaatcactgcgttttcacacagagaaaaatcactcacccttctcagaggcccaagacacccccaacagatatcatcgtgtacacggaacttccaaatgctgagccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 - fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) - solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 - solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 |