Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
APBB1IP-amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein Gene
PTXBC035636
New product
Data sheet of APBB1IP-amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about APBB1IP-amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035636 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | APBB1IP |
| Origin species: | Human |
| Product name: | APBB1IP-amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein Gene |
| Size: | 2ug |
| Accessions: | BC035636 |
| Gene id: | 54518 |
| Gene description: | amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein |
| Synonyms: | INAG1; PREL1; RARP1; RIAM; amyloid beta A4 precursor protein-binding family B member 1-interacting protein; APBB1-interacting protein 1; PREL-1; RARP-1; Rap1-GTP-interacting adaptor molecule; Rap1-interacting adaptor molecule; proline rich EVH1 ligand 1; proline-rich protein 73; rap1-GTP-interacting adapter molecule; retinoic acid-responsive proline-rich protein 1; amyloid beta precursor protein binding family B member 1 interacting protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtgagtcaagtgaagacatagaccaaatgttcagcactttgctgggagagatggatcttctgactcagagtttaggagttgacactctccctcctcctgaccctaatccacccagagctgaatttaactacagtgtggggtttaaagatttaaatgagtccttaaatgcactggaagaccaagatttagatgctctcatggcagatctggtagcagacataagtgaggctgagcagaggacaatccaggcacagaaagagtccttgcagaatcaacatcattcagcatctctacaagcatcaattttcagtggtgcagcctctcttggttatggaacaaatgttgctgccactggtatcagccaatatgaggatgacttaccacctccaccagccgatcctgtgttagaccttccactgccaccaccacctcctgaacctctctctcaggtaagtatgtgggaccagagatggcaggaccatcaacctctgctacctatcactgatgttccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1 - tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) - prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) - interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40) |