CD48-CD48 molecule Gene View larger

CD48-CD48 molecule Gene

PTXBC030224

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD48-CD48 molecule Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD48-CD48 molecule Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030224
Product type: DNA & cDNA
Ncbi symbol: CD48
Origin species: Human
Product name: CD48-CD48 molecule Gene
Size: 2ug
Accessions: BC030224
Gene id: 962
Gene description: CD48 molecule
Synonyms: CD48 molecule; CD48 antigen (B-cell membrane protein); CD48 antigen; BCM1; BLAST; BLAST1; MEM-102; SLAMF2; hCD48; mCD48; B-lymphocyte activation marker BLAST-1; BCM1 surface antigen; SLAM family member 2; TCT.1; leukocyte antigen MEM-102; signaling lymphocytic activation molecule 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgctccagaggttgggattcgtgtctggctctggaattgctactgctgcctctgtcactcctggtgaccagcattcaaggtcacttggtacatatgaccgtggtctccggcagcaacgtgactctgaacatctctgagagcctgcctgagaactacaaacaactaacctggttttatactttcgaccagaagattgtagaatgggattccagaaaatctaagtactttgaatccaaatttaaaggcagggtcagacttgatcctcagagtggcgcactgtacatctctaaggtccagaaagaggacaacagcacctacatcatgagggtgttgaaaaagactgggaatgagcaagaatggaagatcaagctgcaagtgcttggtgagtcaggggagccaaagagcaaatccccactccagtggccccagatggaccactgtagggcttcctgggaggcatggggcactctcggggaggaggagagaaaaacctcaggacaggtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD33 molecule
- paralemmin 2
- annexin A11
- TSPY-like 4

Reviews

Buy CD48-CD48 molecule Gene now

Add to cart