Cart 1 Product Products 121,50 € (empty)
-
1 x IMPACT-Imp...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
View larger 
Data sheet of DNAJB4-DnaJ (Hsp40) homolog, subfamily B, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJB4-DnaJ (Hsp40) homolog, subfamily B, member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034721 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJB4 |
| Origin species: | Human |
| Product name: | DNAJB4-DnaJ (Hsp40) homolog, subfamily B, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC034721 |
| Gene id: | 11080 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily B, member 4 |
| Synonyms: | DNAJW; DjB4; HLJ1; dnaJ homolog subfamily B member 4; DnaJ (Hsp40) homolog, subfamily B, member 4; DnaJ-like heat shock protein 40; HSP40 homolog; heat shock 40 kDa protein 1 homolog; heat shock protein 40 homolog; human liver DnaJ-like protein; DnaJ heat shock protein family (Hsp40) member B4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggaaagactattattgcattttgggaattgagaaaggagcttcagatgaagatattaaaaaggcttaccgaaaacaagccctcaaatttcatccggacaagaacaaatctcctcaggcagaggaaaaatttaaagaggtcgcagaagcttatgaagtattgagtgatcctaaaaagagagaaatatatgatcagtttggggaggaagggttgaaaggaggagcaggaggtactgatggacaaggaggtaccttccggtacacctttcatggcgatcctcatgctacatttgctgcatttttcggagggtccaacccctttgaaattttctttggaagacgaatgggtggtggtagagattctgaagaaatggaaatagatggtgatccttttagtgcctttggtttcagcatgaatggatatccaagagacaggaattctgtggggccatcccgcctcaaacaagatcctccagttattcatgaacttagagtatcacttgaagagatatatagtggttgtaccaaacggatgaagatttctcgaaaaaggctaaacgctgatggaaggagttacagatctgaggacaaaattcttaccattgagattaaaaaagggtggaaagaaggcaccaaaattacttttccaagagaaggagatgaaacaccaaatagtattccagcagacattgtttttatcattaaagacaaagatcatccaaaatttaaaagggatggatcaaatataatttatactgctaaaattagtttacgagaggcattgtgtggctgctcaattaatgtaccaacactggatggaagaaacatacctatgtcagtaaatgatattgtgaaacccggaatgaggagaagaattattggatatgggctgccatttccaaaaaatcctgaccaacgtggtgaccttctaatagaatttgaggtgtccttcccagatactatatcttcttcatccaaagaagtacttaggaaacatcttcctgcctcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily B, member 1 - major histocompatibility complex, class I, E - ARP2 actin-related protein 2 homolog (yeast) - DnaJ (Hsp40) homolog, subfamily A, member 4 |