Cart 7 Product Products 790,32 € (empty)
-
1 x ANKRD44-an...121,50 € -
1 x MOBP-myeli...113,40 € -
1 x CYTIP-cyto...121,50 € -
1 x C19orf47-c...121,50 € -
-
-
No products
To be determined Shipping
790,32 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 790,32 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 790,32 €
View larger 
P2RY6-pyrimidinergic receptor P2Y, G-protein coupled, 6 Gene
PTXBC000571
New product
Data sheet of P2RY6-pyrimidinergic receptor P2Y, G-protein coupled, 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about P2RY6-pyrimidinergic receptor P2Y, G-protein coupled, 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000571 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | P2RY6 |
| Origin species: | Human |
| Product name: | P2RY6-pyrimidinergic receptor P2Y, G-protein coupled, 6 Gene |
| Size: | 2ug |
| Accessions: | BC000571 |
| Gene id: | 5031 |
| Gene description: | pyrimidinergic receptor P2Y, G-protein coupled, 6 |
| Synonyms: | P2Y purinoceptor 6; G-coupled nucleotide receptor; P2 purinoceptor; P2Y6 receptor; pyrimidinergic receptor P2Y, G-protein coupled, 6; pyrimidinergic receptor P2Y6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaatgggacaatggcacaggccaggctctgggcttgccacccaccacctgtgtctaccgcgagaacttcaagcaactgctgctgccacctgtgtattcggcggtgctggcggctggcctgccgctgaacatctgtgtcattacccagatctgcacgtcccgccgggccctgacccgcacggccgtgtacaccctaaaccttgctctggctgacctgctatatgcctgctccctgcccctgctcatctacaactatgcccaaggtgatcactggccctttggcgacttcgcctgccgcctggtccgcttcctcttctatgccaacctgcacggcagcatcctcttcctcacctgcatcagcttccagcgctacctgggcatctgccacccgctggccccctggcacaaacgtgggggccgccgggctgcctggctagtgtgtgtagccgtgtggctggccgtgacaacccagtgcctgcccacagccatcttcgctgccacaggcatccagcgtaaccgcactgtctgctatgacctcagcccgcctgccctggccacccactatatgccctatggcatggctctcactgtcatcggcttcctgctgccctttgctgccctgctggcctgctactgtctcctggcctgccgcctgtgccgccaggatggcccggcagagcctgtggcccaggagcggcgtggcaaggcggcccgcatggccgtggtggtggctgctgcctttgccatcagcttcctgccttttcacatcaccaagacagcctacctggcagtgcgctcgacgccgggcgtcccctgcactgtattggaggcctttgcagcggcctacaaaggcacgcggccgtttgccagtgccaacagcgtgctggaccccatcctcttctacttcacccagaagaagttccgccggcgaccacatgagctcctacagaaactcacagccaaatggcagaggcagggtcgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - differentially expressed in FDCP 6 homolog (mouse) - carbohydrate (chondroitin 4) sulfotransferase 11 - protein tyrosine phosphatase, non-receptor type 2 - non imprinted in Prader-Willi/Angelman syndrome 2 |