Cart 21 Product Products 2 908,59 € (empty)
-
1 x MYOG-myoge...113,40 € -
1 x HLA-DQA1-m...113,40 € -
1 x HLA-C-majo...121,50 € -
1 x TRIM65-tri...113,40 € -
1 x C12orf60-c...113,40 € -
1 x EGFL7-EGF-...121,50 € -
1 x FOSL2-FOS-...121,50 € -
1 x LY9-lympho...113,40 € -
1 x LTV1-LTV1...121,50 € -
1 x DEXI-dexam...113,40 € -
1 x C9orf41-ch...121,50 € -
1 x HLA-A-majo...121,50 € -
1 x GPR39-G...121,50 € -
1 x LOC158381-...113,40 € -
1 x MCM10-mini...121,50 € -
1 x HLA-B-majo...121,50 € -
1 x TFDP1-tran...121,50 € -
1 x PYHIN1-pyr...113,40 € -
1 x TTLL10-tub...121,50 € -
-
No products
To be determined Shipping
2 908,59 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 21 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 908,59 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 908,59 €
Data sheet of FRZB-frizzled-related protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FRZB-frizzled-related protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027855 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FRZB |
| Origin species: | Human |
| Product name: | FRZB-frizzled-related protein Gene |
| Size: | 2ug |
| Accessions: | BC027855 |
| Gene id: | 2487 |
| Gene description: | frizzled-related protein |
| Synonyms: | FRZB-PEN; FRZB-1; FRE; FRITZ; FRP-3; FRZB1; FZRB; OS1; SFRP3; SRFP3; hFIZ; secreted frizzled-related protein 3; frezzled; frizzled homolog-related; frizzled-related protein 1; sFRP-3; frizzled-related protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtctgcggcagcccgggagggatgctgctgctgcgggccgggctgcttgccctggctgctctctgcctgctccgggtgcccggggctcgggctgcagcctgtgagcccgtccgcatccccctgtgcaagtccctgccctggaacatgactaagatgcccaaccacctgcaccacagcactcaggccaacgccatcctggccatcgagcagttcgaaggtctgctgggcacccactgcagccccgatctgctcttcttcctctgtgccatgtacgcgcccatctgcaccattgacttccagcacgagcccatcaagccctgtaagtctgtgtgcgagcgggcccggcagggctgtgagcccatactcatcaagtaccgccactcgtggccggagaacctggcctgcgaggagctgccagtgtacgacaggggcgtgtgcatctctcccgaggccatcgttactgcggacggagctgattttcctatggattctagtaacggaaactgtagaggggcaagcagtgaacgctgtaaatgtaagcctattagagctacacagaagacctatttccggaacaattacaactatgtcattcgggctaaagttaaagagataaagactaagtgccatgatgtgactgcagtagtggaggtgaaggagattctaaagtcctctctggtaaacattccacgggacactgtcaacctctataccagctctggctgcctctgccctccacttaatgttaatgaggaatatatcatcatgggctatgaagatgaggaacgttccagattactcttggtggaaggctctatagctgagaagtggaaggatcgactcggtaaaaaagttaagcgctgggatatgaagcttcgtcatcttggactcagtaaaagtgattctagcaatagtgattccactcagagtcagaagtctggcaggaactcgaacccccggcaagcacgcaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - programmed cell death 6 - BEN domain containing 7 - UBA domain containing 1 - N-myristoyltransferase 2 |