> >>SPA17-sperm autoantigenic protein 17 Gene
SPA17-sperm autoantigenic protein 17 Gene View larger

SPA17-sperm autoantigenic protein 17 Gene

PTXBC032457

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of SPA17-sperm autoantigenic protein 17 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPA17-sperm autoantigenic protein 17 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032457
Product type: DNA & cDNA
Ncbi symbol: SPA17
Origin species: Human
Product name: SPA17-sperm autoantigenic protein 17 Gene
Size: 2ug
Accessions: BC032457
Gene id: 53340
Gene description: sperm autoantigenic protein 17
Synonyms: CT22; SP17; SP17-1; sperm surface protein Sp17; cancer/testis antigen 22; sperm autoantigenic protein 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgattccattctccaacacccactaccgaattccacaaggatttgggaatcttcttgaagggctgacacgcgagattctgagagagcaaccggacaatataccagcttttgcagcagcctattttgagagccttctagagaaaagagagaaaaccaactttgatccagcagaatgggggagtaaggtagaagaccgcttctataacaatcatgcattcgaggagcaagaaccacctgagaaaagtgatcctaaacaagaagagtctcagatatctgggaaggaggaagagacatcagtcaccatcttagactcttctgaggaagataaggaaaaagaagaggttgctgctgtcaaaatccaagctgccttccggggacacatagccagagaggaggcaaagaaaatgaaaacaaatagtcttcaaaatgaggaaaaagaggaaaacaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - parathyroid hormone 1 receptor
- FK506 binding protein 8, 38kDa
- dual specificity phosphatase 6
- RAD51-like 1 (S. cerevisiae)

Reviews

Buy SPA17-sperm autoantigenic protein 17 Gene now

Add to cart