Cart 4 Product Products 437,06 € (empty)
-
1 x DRD5-dopam...121,50 € -
-
1 x FAM70B-fam...121,50 € -
1 x FAM71E2-fa...113,40 €
No products
To be determined Shipping
437,06 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 437,06 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 437,06 €
Data sheet of MAGEA8-melanoma antigen family A, 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAGEA8-melanoma antigen family A, 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002455 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAGEA8 |
| Origin species: | Human |
| Product name: | MAGEA8-melanoma antigen family A, 8 Gene |
| Size: | 2ug |
| Accessions: | BC002455 |
| Gene id: | 4107 |
| Gene description: | melanoma antigen family A, 8 |
| Synonyms: | CT1.8; MAGE8; melanoma-associated antigen 8; MAGE-8 antigen; cancer/testis antigen 1.8; cancer/testis antigen family 1, member 8; melanoma antigen family A, 8; melanoma antigen family A8; MAGE family member A8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcttcttgggcagaagagtcagcgctacaaggctgaggaaggccttcaggcccaaggagaggcaccagggcttatggatgtgcagattcccacagctgaggagcagaaggctgcatcctcctcctctactctgatcatgggaacccttgaggaggtgactgattctgggtcaccaagtcctccccagagtcctgagggtgcctcctcttccctgactgtcaccgacagcactctgtggagccaatccgatgagggttccagcagcaatgaagaggaggggccaagcacctccccggacccagctcacctggagtccctgttccgggaagcacttgatgagaaagtggctgagttagttcgtttcctgctccgcaaatatcaaattaaggagccggtcacaaaggcagaaatgcttgagagtgtcatcaaaaattacaagaaccactttcctgatatcttcagcaaagcctctgagtgcatgcaggtgatctttggcattgatgtgaaggaagtggaccctgccggccactcctacatccttgtcacctgcctgggcctctcctatgatggcctgctgggtgatgatcagagtacgcccaagaccggcctcctgataatcgtcctgggcatgatcttaatggagggcagccgcgccccggaggaggcaatctgggaagcgttgagtgtgatggggctgtatgatgggagggagcacagtgtctattggaagctcaggaagctgctcacccaagagtgggtgcaggagaactacctggagtaccgccaggcgcccggcagtgatcctgtgcgctacgagttcctgtggggtccaagggcccttgctgaaaccagctatgtgaaagtcctggagcatgtggtcagggtcaatgcaagagttcgcatttcctacccatccctgcatgaagaggctttgggagaggagaaaggagtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - atonal homolog 7 (Drosophila) - complement factor H-related 1 - ribonuclease H2, subunit B - GTPase, IMAP family member 2 |