Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FAM134B-family with sequence similarity 134, member B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM134B-family with sequence similarity 134, member B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030517 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM134B |
| Origin species: | Human |
| Product name: | FAM134B-family with sequence similarity 134, member B Gene |
| Size: | 2ug |
| Accessions: | BC030517 |
| Gene id: | 54463 |
| Gene description: | family with sequence similarity 134, member B |
| Synonyms: | protein FAM134B; reticulophagy receptor FAM134B; JK-1; JK1; family with sequence similarity 134 member B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaacaaatgatgaagatgaattaagccttggtttgcccactgagctcaagagaaagaaggaacagttggacagtggtcacagaccaagcaaagagacgcaatcagcagctggtctcacccttcctctgaacagtgaccaaacctttcacctgatgagcaacctggctggggatgttatcacagctgcagtgactgcagctatcaaagaccagttagagggtgtgcagcaagcactttctcaggctgcccccatcccagaagaggacacagacactgaagaaggtgatgactttgaactacttgaccagtcagagctggatcaaattgagagtgaattgggacttacacaagaccaggaagcagaagcacagcaaaataagaagtcttcaggtttcctttcaaatctgctgggaggccattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - poly (ADP-ribose) polymerase family, member 16 - dehydrogenase/reductase (SDR family) member 13 - purinergic receptor P2Y, G-protein coupled, 14 - ARP3 actin-related protein 3 homolog B (yeast) |