Cart 1 Product Products 112,04 € (empty)
No products
To be determined Shipping
112,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 112,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 112,04 €
View larger 
HSP90B1-heat shock protein 90kDa beta (Grp94), member 1 Gene
PTXBC009195
New product
Data sheet of HSP90B1-heat shock protein 90kDa beta (Grp94), member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HSP90B1-heat shock protein 90kDa beta (Grp94), member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009195 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HSP90B1 |
| Origin species: | Human |
| Product name: | HSP90B1-heat shock protein 90kDa beta (Grp94), member 1 Gene |
| Size: | 2ug |
| Accessions: | BC009195 |
| Gene id: | 7184 |
| Gene description: | heat shock protein 90kDa beta (Grp94), member 1 |
| Synonyms: | ECGP; GP96; HEL-S-125m; HEL35; TRA1; endoplasmin; 94 kDa glucose-regulated protein; endothelial cell (HBMEC) glycoprotein; epididymis luminal protein 35; epididymis secretory sperm binding protein Li 125m; heat shock protein 90 kDa beta member 1; heat shock protein 90kDa beta (Grp94), member 1; heat shock protein 90kDa beta family member 1; stress-inducible tumor rejection antigen gp96; tumor rejection antigen (gp96) 1; tumor rejection antigen 1; heat shock protein 90 beta family member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagggccctgtgggtgctgggcctctgctgcgtcctgctgaccttcgggtcggtcagagctgacgatgaagttgatgtggatggtacagtagaagaggatctgggtaaaagtagagaaggatcaaggacggatgatgaagtagtacagagagaggaagaagctattcagttggatggattaaatgcatcacaaataagagaacttagagagaagtcggaaaagtttgccttccaagccgaagttaacagaatgatgaaacttatcatcaattcattgtataaaaataaagagattttcctgagagaactgatttcaaatgcttctgatgctttagataagataaggctaatatcactgactgatgaaaatgctctttctggaaatgaggaactaacagtcaaaattaagtgtgataaggagaagaacctgctgcatgtcacagacaccggtgtaggaatgaccagagaagagttggttaaaaaccttggtaccatagccaaatctgggacaagcgagtttttaaacaaaatgactgaagcacaggaagatggccagtcaacttctgaattgattggccagtttggtgtcggtttctattccgccttccttgtagcagataaggttattgtcacttcaaaacacaacaacgatacccagcacatctgggagtctgactccaatgaattttctgtaattgctgacccaagaggaaacactctaggacggggaacgacaattacccttgtcttaaaagaagaagcatctgattaccttgaattggatacaattaaaaatctcgtcaaaaaatattcacagttcataaactttcctatttatgtatggagcagcaagactgaaactgttgaggagcccatggaggaagaagaagcagccaaagaagagaaagaagaatctgatgatgaagctgcagcaagacgaagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - beta-1,4-N-acetyl-galactosaminyl transferase 1 - pyrimidinergic receptor P2Y, G-protein coupled, 6 - differentially expressed in FDCP 6 homolog (mouse) - carbohydrate (chondroitin 4) sulfotransferase 11 |