Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GIMAP5-GTPase, IMAP family member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GIMAP5-GTPase, IMAP family member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011732 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GIMAP5 |
| Origin species: | Human |
| Product name: | GIMAP5-GTPase, IMAP family member 5 Gene |
| Size: | 2ug |
| Accessions: | BC011732 |
| Gene id: | 55340 |
| Gene description: | GTPase, IMAP family member 5 |
| Synonyms: | HIMAP3; IAN-5; IAN4; IAN4L1; IAN5; IMAP3; IROD; GTPase IMAP family member 5; immune associated nucleotide 4 like 1; immune-associated nucleotide-binding protein 5; immunity associated protein 3; immunity-associated nucleotide 5 protein; inhibitor of radiation- and OA-induced apoptosis, Irod/Ian5; GTPase, IMAP family member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaggattccagaggggcaaatatggaactatggctgaaggtagatcagaagataacttgtctgcaacaccaccggcattgaggattatcctagtgggcaaaacaggctgcgggaaaagtgccacagggaacagcatccttggccagcccgtgtttgagtccaagctgagggcccagtcagtgaccaggacgtgccaggtgaaaacaggaacatggaacgggaggaaagtcctggtggttgacacgccctccatctttgagtcacaggccgatacccaagagctgtacaagaacatcggggactgctacctgctctctgccccggggccccacgtcctgcttctggtgatccagctggggcgtttcactgctcaggacacagtggccatcaggaaggtgaaagaggtctttgggacaggggccatgagacatgtggtcatcctcttcacccacaaagaggacttagggggccaggccctggatgactatgtagcaaacacggacaactgcagcctgaaagacctggtgcgggagtgtgagagaaggtactgtgccttcaacaactggggctctgtggaggagcagaggcagcagcaggcagagctcctggctgtgattgagaggctggggagggagcgagagggctccttccacagcaatgacctcttcttggatgcccagctgctccaaagaactggagctggggcctgccaggaagactacaggcagtaccaggccaaagtggaatggcaggtggagaagcacaagcaagagctgagggagaacgagagtaactgggcatacaaggcgctcctcagagtcaaacacttgatgcttttgcattatgagatttttgtttttctattgttgtgcagcatactttttttcattatttttctgttcatctttcattacatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - N-terminal asparagine amidase - melanoma antigen family A, 8 - atonal homolog 7 (Drosophila) - complement factor H-related 1 |