Cart 1 Product Products 113,40 € (empty)
-
1 x SDC4-synde...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
KCNE3-potassium voltage-gated channel, Isk-related family, member 3 Gene
PTXBC032235
New product
Data sheet of KCNE3-potassium voltage-gated channel, Isk-related family, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNE3-potassium voltage-gated channel, Isk-related family, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032235 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNE3 |
| Origin species: | Human |
| Product name: | KCNE3-potassium voltage-gated channel, Isk-related family, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC032235 |
| Gene id: | 10008 |
| Gene description: | potassium voltage-gated channel, Isk-related family, member 3 |
| Synonyms: | HOKPP; HYPP; MiRP2; potassium voltage-gated channel subfamily E member 3; cardiac voltage-gated potassium channel accessory subunit; minK-related peptide 2; minimum potassium ion channel-related peptide 2; potassium channel subunit beta MiRP2; potassium channel, voltage gated subfamily E regulatory beta subunit 3; potassium voltage-gated channel, Isk-related family, member 3; voltage-gated K+ channel subunit MIRP2; potassium voltage-gated channel subfamily E regulatory subunit 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagactaccaatggaacggagacctggtatgagagcctgcatgccgtgctgaaggctctaaatgccactcttcacagcaatttgctctgccggccagggccagggctggggccagacaaccagactgaagagaggcgggccagcctacctggccgtgatgacaactcctacatgtacattctctttgtcatgtttctatttgctgtaactgtgggcagcctcatcctgggatacacccgctcccgcaaagtggacaagcgtagtgacccctatcatgtgtatatcaagaaccgtgtgtctatgatctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein kinase, AMP-activated, gamma 2 non-catalytic subunit - dolichyl-diphosphooligosaccharide-protein glycosyltransferase - Cas-Br-M (murine) ecotropic retroviral transforming sequence c - solute carrier organic anion transporter family, member 6A1 |