PTXBC000618
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC000618 |
Product type: | DNA & cDNA |
Ncbi symbol: | ELOVL1 |
Origin species: | Human |
Product name: | ELOVL1-elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 Gene |
Size: | 2ug |
Accessions: | BC000618 |
Gene id: | 64834 |
Gene description: | elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 |
Synonyms: | 3-keto acyl-CoA synthase ELOVL1; CGI-88; Ssc1; elongation of very long chain fatty acids protein 1; ELOVL FA elongase 1; elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1; very long chain 3-ketoacyl-CoA synthase 1; very long chain 3-oxoacyl-CoA synthase 1; ELOVL fatty acid elongase 1 |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atggaggctgttgtgaacttgtaccaagaggtgatgaagcacgcagatccccggatccagggctaccctctgatggggtcccccttgctaatgacctccattctcctgacctacgtgtacttcgttctctcacttgggcctcgcatcatggctaatcggaagcccttccagctccgtggcttcatgattgtctacaacttctcactggtggcactctccctctacattgtctatgagttcctgatgtcgggctggctgagcacctatacctggcgctgtgaccctgtggactattccaacagccctgaggcacttaggatggttcgggtggcctggctcttcctcttctccaagttcattgagctgatggacacagtgatctttattctccgaaagaaagacgggcaggtgaccttcctacatgtcttccatcactctgtgcttccctggagctggtggtggggggtaaagattgccccgggaggaatgggctctttccatgccatgataaactcttccgtgcatgtcataatgtacctgtactacggattatctgcctttggccctgtggcacaaccctacctttggtggaaaaagcacatgacagccattcagctgatccagtttgtcctggtctcactgcacatctcccagtactactttatgtccagctgtaactaccagtacccagtcattattcacctcatctggatgtatggcaccatcttcttcatgctgttctccaacttctggtatcactcttataccaagggcaagcggctgccccgtgcacttcagcaaaatggagctccaggtattgccaaggtcaaggccaactga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) - sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae) - elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 - elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 |