Cart 2 Product Products 225,44 € (empty)
-
1 x PYCR1-pyrr...113,40 € -
No products
To be determined Shipping
225,44 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 225,44 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 225,44 €
View larger 
Data sheet of SPINK1-serine peptidase inhibitor, Kazal type 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPINK1-serine peptidase inhibitor, Kazal type 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025790 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPINK1 |
| Origin species: | Human |
| Product name: | SPINK1-serine peptidase inhibitor, Kazal type 1 Gene |
| Size: | 2ug |
| Accessions: | BC025790 |
| Gene id: | 6690 |
| Gene description: | serine peptidase inhibitor, Kazal type 1 |
| Synonyms: | PCTT; PSTI; Spink3; TATI; TCP; serine protease inhibitor Kazal-type 1; pancreatic secretory trypsin inhibitor; serine protease inhibitor, Kazal type 1; tumor-associated trypsin inhibitor; serine peptidase inhibitor, Kazal type 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggtaacaggcatctttcttctcagtgccttggccctgttgagtctatctggtaacactggagctgactccctgggaagagaggccaaatgttacaatgaacttaatggatgcaccaagatatatgaccctgtctgtgggactgatggaaatacttatcccaatgaatgcgtgttatgttttgaaaatcggaaacgccagacttctatcctcattcaaaaatctgggccttgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ankyrin repeat domain 1 (cardiac muscle) - glycerol-3-phosphate dehydrogenase 1-like - zinc finger and BTB domain containing 37 - cholinergic receptor, nicotinic, alpha 3 |