ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene View larger

ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene

PTXBC017314

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017314
Product type: DNA & cDNA
Ncbi symbol: ETS1
Origin species: Human
Product name: ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene
Size: 2ug
Accessions: BC017314
Gene id: 2113
Gene description: v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)
Synonyms: ETS-1; EWSR2; c-ets-1; p54; protein C-ets-1; Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1; v-ets avian erythroblastosis virus E2 oncogene homolog 1; v-ets avian erythroblastosis virus E26 oncogene homolog 1; ETS proto-oncogene 1, transcription factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggcggccgtcgatctcaagccgactctcaccatcatcaagacggaaaaagtcgatctggagcttttcccctccccggatatggaatgtgcagatgtcccactattaactccaagcagcaaagaaatgatgtctcaagcattaaaagctactttcagtggtttcactaaagaacagcaacgactggggatcccaaaagacccccggcagtggacagaaacccatgttcgggactgggtgatgtgggctgtgaatgaattcagcctgaaaggtgtagacttccagaagttctgtatgaatggagcagccctctgcgccctgggtaaagactgctttctcgagctggccccagactttgttggggacatcttatgggaacatctagagatcctgcagaaagaggatgtgaaaccatatcaagttaatggagtcaacccagcctatccagaatcccgctatacctcggattacttcattagctatggtattgagcatgcccagtgtgttccaccatcggagttctcagagcccagcttcatcacagagtcctatcagacgctccatcccatcagctcggaagagctcctctccctcaagtatgagaatgactacccctcggtcattctccgagaccctctccagacagacaccttgcagaatgactactttgctatcaaacaagaagtcgtcaccccagacaacatgtgcatggggaggaccagtcgtggtaaactcgggggccaggactcttttgaaagcatagagagctacgatagttgtggccaggagatggggaaagaggaaaaacaaacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
- protein phosphatase 1, regulatory (inhibitor) subunit 3C
- 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1
- par-6 partitioning defective 6 homolog alpha (C. elegans)

Reviews

Buy ETS1-v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) Gene now

Add to cart