Cart 2 Product Products 216,18 € (empty)
-
1 x C21orf49-c...113,40 € -
No products
To be determined Shipping
216,18 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 216,18 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 216,18 €
View larger 
Data sheet of SULT4A1-sulfotransferase family 4A, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SULT4A1-sulfotransferase family 4A, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028171 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SULT4A1 |
| Origin species: | Human |
| Product name: | SULT4A1-sulfotransferase family 4A, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC028171 |
| Gene id: | 25830 |
| Gene description: | sulfotransferase family 4A, member 1 |
| Synonyms: | BR-STL-1; BRSTL1; DJ388M5.3; NST; SULTX3; hBR-STL-1; sulfotransferase 4A1; ST4A1; brain sulfotransferase-like protein; hBR-STL; nervous system cytosolic sulfotransferase; nervous system sulfotransferase; sulfotransferase-related protein; sulfotransferase family 4A member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggagagcgaggccgagacccccagcaccccgggggagttcgagagcaagtacttcgagttccatggcgtgcggctgccgcccttctgccgcgggaagatggaggagatcgccaacttcccggtgcggcccagcgacgtgtggatcgtcacctaccccaagtccggcaccagcttgctgcaggaggtggtctacttggtgagccagggcgctgaccccgatgagatcggcttgatgaacatcgacgagcagctcccggtcctggagtacccacagccgggcctggacatcatcaaggaactgacctctccccgcctcatcaagagccacctgccctaccgctttctgccctctgacctccacaatggagactccaaggtcatctatatggctcgcaaccccaaggatctggtggtgtcttattatcagttccaccgctctctgcggaccatgagctaccgaggcacctttcaagaattctgccggaggtttatgaatgataagctgggctacggctcctggtttgagcacgtgcaggagttctgggagcaccgcatggactcgaacgtgctttttctcaagtatgaagacatgcatcgggacctggtgacgatggtggagcagctggccagattcctgggggtgtcctgtgacaaggcccagctggaagccctgacggagcactgccaccagctggtggaccagtgctgcaacgctgaggccctgcccgtgggccgggcacattgcgtctttgctcggaagatcttcttgagttggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 16 open reading frame 61 - chromosome 1 open reading frame 211 - chromosome 21 open reading frame 59 - chromosome 6 open reading frame 218 |