Cart 7 Product Products 1 142,07 € (empty)
-
-
1 x CCNI-cycli...121,50 € -
-
1 x SETDB1-SET...121,50 € -
1 x IFNAR2-int...121,50 € -
1 x SETMAR-SET...121,50 € -
No products
To be determined Shipping
1 142,07 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 142,07 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 142,07 €
Data sheet of KCNIP4-Kv channel interacting protein 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNIP4-Kv channel interacting protein 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032520 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNIP4 |
| Origin species: | Human |
| Product name: | KCNIP4-Kv channel interacting protein 4 Gene |
| Size: | 2ug |
| Accessions: | BC032520 |
| Gene id: | 80333 |
| Gene description: | Kv channel interacting protein 4 |
| Synonyms: | CALP; KCHIP4; Kv channel-interacting protein 4; Kv channel interacting protein 4; a-type potassium channel modulatory protein 4; calsenilin-like protein; potassium channel interacting protein 4; potassium voltage-gated channel interacting protein 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatgtgaggagggtggaaagcatttcggctcagctggaggaggccagctctacaggcggtttcctgtacgctcagaacagcaccaagcgcagcattaaagagcggctcatgaagctcttgccctgctcagctgccaaaacgtcgtctcctgctattcaaaacagcgtggaagatgaactggagatggccaccgtcaggcatcggcccgaagcccttgagcttctggaagcccagagcaaatttaccaagaaagagcttcagatcctttacagaggatttaagaacgaatgccccagtggtgttgttaatgaagaaaccttcaaagagatttactcgcagttctttccacagggagactctacaacatatgcacattttctgttcaatgcatttgatacagaccacaatggagctgtgagtttcgaggatttcatcaaaggtctttccattttgctccgggggacagtacaagaaaaactcaattgggcatttaatctgtatgacataaataaagatggctacatcactaaagaggaaatgcttgatataatgaaagcaatatacgatatgatgggtaaatgtacatatcctgtcctcaaagaagatgctcccagacaacacgttgaaacattttttcagaaaatggacaaaaataaagatggggttgttaccatagatgagttcattgaaagctgccaaaaagatgaaaacataatgcgctccatgcagctctttgaaaatgtgatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Der1-like domain family, member 1 - proliferating cell nuclear antigen - abhydrolase domain containing 10 - BMI1 polycomb ring finger oncogene |