Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6V1D-ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D Gene
PTXBC001411
New product
Data sheet of ATP6V1D-ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6V1D-ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001411 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6V1D |
| Origin species: | Human |
| Product name: | ATP6V1D-ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D Gene |
| Size: | 2ug |
| Accessions: | BC001411 |
| Gene id: | 51382 |
| Gene description: | ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D |
| Synonyms: | ATP6M; VATD; VMA8; V-type proton ATPase subunit D; ATPase, H+ transporting lysosomal, member M; ATPase, H+ transporting, lysosomal (vacuolar proton pump); ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D; H(+)-transporting two-sector ATPase, subunit M; V-ATPase 28 kDa accessory protein; V-ATPase D subunit; V-ATPase subunit D; vacuolar ATP synthase subunit D; vacuolar H-ATPase subunit D; vacuolar proton pump D subunit; vacuolar proton pump delta polypeptide; vacuolar proton pump subunit D; vacuolar proton-ATPase subunit D; ATPase H+ transporting V1 subunit D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgggcaaagaccgaattgaaatctttccctcgcgaatggcacagaccatcatgaaggctcgtttaaagggagcacagacaggtcgaaacctcctgaagaaaaaatctgatgccttaactcttcgatttcgacagatcctaaagaagataatagagactaaaatgttgatgggcgaagtgatgagagaagctgccttttcactagctgaagccaagttcacagcaggtgacttcagcactacagttatccaaaatgtcaataaagcgcaagtgaagattcgagcgaagaaagataatgtagcaggtgttactttgccagtatttgaacattaccatgaaggaactgacagttatgaactgactggtttagccagaggtggggaacagttggctaaattaaagaggaattatgccaaagcagtggaactactggtggaactagcttctctgcagacttcttttgttactttggatgaagctattaagataaccaacaggcgtgtaaatgccattgaacatgtcatcattccccggattgaacgtactcttgcttatatcatcacagagctggatgagagagagcgagaagagttctataggttaaagaaaatacaagagaagaaaaagattctaaaggaaaaatctgagaaggacttggagcaaaggagagcagctggagaggtgttggagcctgctaatcttctggctgaagagaaggacgaggatcttctatttgaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - major histocompatibility complex, class II, DR beta 1 - major histocompatibility complex, class II, DR beta 3 - protein phosphatase 1, catalytic subunit, gamma isoform - G protein-coupled receptor, family C, group 5, member A |