PSMB1-proteasome (prosome, macropain) subunit, beta type, 1 Gene View larger

PSMB1-proteasome (prosome, macropain) subunit, beta type, 1 Gene

PTXBC000508

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMB1-proteasome (prosome, macropain) subunit, beta type, 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSMB1-proteasome (prosome, macropain) subunit, beta type, 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000508
Product type: DNA & cDNA
Ncbi symbol: PSMB1
Origin species: Human
Product name: PSMB1-proteasome (prosome, macropain) subunit, beta type, 1 Gene
Size: 2ug
Accessions: BC000508
Gene id: 5689
Gene description: proteasome (prosome, macropain) subunit, beta type, 1
Synonyms: HC5; PMSB1; PSC5; proteasome subunit beta type-1; macropain subunit C5; multicatalytic endopeptidase complex subunit C5; proteasome (prosome, macropain) subunit, beta type, 1; proteasome beta 1 subunit; proteasome component C5; proteasome gamma chain; proteasome subunit HC5; testicular secretory protein Li 45; proteasome subunit beta 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgtcctctacagccatgtattcggctgctggcagagacttggggatggaaccgcacagagccgcgggccctttgcagctgcgattttcgccctacgttttcaacggaggtactatactggcaattgctggagaagattttgcaattgttgcttctgatactcgattgagtgaagggttttcaattcatacgcgggatagccccaaatgttacaaattaacagacaaaacagtcattggatgcagcggttttcatggagactgtcttacgctgacaaagattattgaagcaagactaaagatgtataagcattccaataataaggccatgactacgggggcaattgctgcaatgctgtctacaatcctgtattcaaggcgcttctttccatactatgtttacaacatcatcggtggacttgatgaagaaggaaagggggctgtatacagctttgatccagtagggtcttaccagagagactccttcaaggctggaggctcagcaagtgccatgctacagcccctgcttgacaaccaggttggttttaagaacatgcagaatgtggagcatgttccgctgtccttggacagagccatgcggctggtgaaagatgtcttcatttctgcggctgagagagatgtgtacactggggacgcactccggatctgcatagtgaccaaagagggcatcagggaggaaactgtttccttaaggaaggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cleavage and polyadenylation specific factor 4, 30kDa
- proteasome (prosome, macropain) subunit, beta type, 7
- nucleophosmin (nucleolar phosphoprotein B23, numatrin)
- nucleophosmin (nucleolar phosphoprotein B23, numatrin)

Reviews

Buy PSMB1-proteasome (prosome, macropain) subunit, beta type, 1 Gene now

Add to cart