WDR32-WD repeat domain 32 Gene View larger

WDR32-WD repeat domain 32 Gene

PTXBC003520

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WDR32-WD repeat domain 32 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WDR32-WD repeat domain 32 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003520
Product type: DNA & cDNA
Ncbi symbol: WDR32
Origin species: Human
Product name: WDR32-WD repeat domain 32 Gene
Size: 2ug
Accessions: BC003520
Gene id: 79269
Gene description: WD repeat domain 32
Synonyms: WDR32; DDB1- and CUL4-associated factor 10; WD repeat domain 32; WD repeat-containing protein 32; DDB1 and CUL4 associated factor 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgaatgaggttaacaccagattgttccaaaatgttgatttcaacgtcctctggatatctcttaattttgcatgaccttgacttaactaactctttagaagtaggcagctatcccattttaagagcaagaagaactacttcaagttcaggagtttcaccacgaaatagtcttgaagtcgtaacccctgaagttcttggtgagagtgaccacggaaactgcatcacgtccttacagctgcacccaaaaggctgggccactcttcttcggtgctcaagcaacagtgatgatgaggagtgtacttgtgtctatgaattccaagaaggagctccagtgcgacctgtctcacctcgctgttctctacgactgactcattacattgaagaagccaatgtaggcaggggttacatcaaagaactttgcttcagccccgatggacgaatgatttcttccccacatggctatgggattcgcttgttgggatttgacaaacagtgcagtgaacttgttgactgcttgcccaaagaagccagtcccctgcgggtgatccgttctctgtactctcataatgatgtggtactgacaacaaagttctctccaacacattgtcagattgcctcagggtgccttagtggacgggtttctttgtatcagccaaagttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S6
- ribosomal protein S6
- ribosomal protein L6
- WD repeat domain 61

Reviews

Buy WDR32-WD repeat domain 32 Gene now

Add to cart