Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
EIF3K-eukaryotic translation initiation factor 3, subunit K Gene
PTXBC001031
New product
Data sheet of EIF3K-eukaryotic translation initiation factor 3, subunit K Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF3K-eukaryotic translation initiation factor 3, subunit K Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001031 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF3K |
| Origin species: | Human |
| Product name: | EIF3K-eukaryotic translation initiation factor 3, subunit K Gene |
| Size: | 2ug |
| Accessions: | BC001031 |
| Gene id: | 27335 |
| Gene description: | eukaryotic translation initiation factor 3, subunit K |
| Synonyms: | ARG134; EIF3-p28; EIF3S12; HSPC029; MSTP001; PLAC-24; PLAC24; PRO1474; PTD001; eukaryotic translation initiation factor 3 subunit K; eIF-3 p28; eukaryotic translation initiation factor 3, subunit 12; muscle specific; muscle-specific gene M9 protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgatgtttgagcagatgagagccaacgtgggcaagttgctcaagggtatcgacaggtacaatcctgagaacctggccaccctggagcgctatgtagagacgcaggccaaggaaaatgcctatgatctggaagccaacctggctgtcctgaagctgtaccagttcaacccagccttctttcagaccacggtcaccgcccagatcctgctgaaggccctcaccaacttgccgcacacagacttcaccctgtgcaagtgcatgatcgaccaggcacatcaagaagaacggccaatccgacagattttgtacctcggggacctgctggagacctgccatttccaggccttctggcaagccctggatgaaaacatggacctcttggaaggtataactggctttgaagactctgtccgaaagtttatctgccatgttgtgggtatcacttaccagcacattgaccgctggctgctggccgagatgctcggggatctgtcggacagccagctaaaggtgtggatgagcaaatacggctggagtgccgacgagtcggggcagatcttcatctgtagccaagaagagagcattaaacccaagaacattgtggagaagattgactttgacagtgtgtccagcatcatggcctcctcccagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) subunit, beta type, 1 - cleavage and polyadenylation specific factor 4, 30kDa - proteasome (prosome, macropain) subunit, beta type, 7 - nucleophosmin (nucleolar phosphoprotein B23, numatrin) |