Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene
PTXBC001277
New product
Data sheet of KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001277 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KDELR3 |
| Origin species: | Human |
| Product name: | KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene |
| Size: | 2ug |
| Accessions: | BC001277 |
| Gene id: | 11015 |
| Gene description: | KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 |
| Synonyms: | ERD2L3; ER lumen protein-retaining receptor 3; KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3; KDEL receptor 3; KDEL endoplasmic reticulum protein retention receptor 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacgtgttccgaatcctcggcgacctgagccacctcctggccatgatcttgctgctggggaagatctggaggtccaagtgctgcaagggcatctctgggaagagccagatcctgtttgctctcgtcttcaccaccaggtacctggacctgttcaccaacttcatctccatctacaacacagtaatgaaggtggtttttctcctctgtgcctatgttacagtgtacatgatatatgggaaattccgtaaaacttttgacagtgagaatgacacattccgcctggagtttcttctggtcccagtcattggcctttccttccttgaaaactacagtttcactctgctggagatcctctggactttctctatctatctggaatcagtggctatcctgccccagctcttcatgatcagcaagactggagaggctgagaccataactactcactacctgttctttctgggtctgtaccgggcactctacctggctaactggatcaggcggtaccagactgagaatttctatgaccaaattgcagtcgtgtctggagtagtacaaaccatcttctactgtgacttcttctacttgtatgtgaccaaagtccttaagggaaagaagttaagtcttccaatgccaatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas) - protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform - transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) - transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) |