RPL13-ribosomal protein L13 Gene View larger

RPL13-ribosomal protein L13 Gene

PTXBC004954

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL13-ribosomal protein L13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL13-ribosomal protein L13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004954
Product type: DNA & cDNA
Ncbi symbol: RPL13
Origin species: Human
Product name: RPL13-ribosomal protein L13 Gene
Size: 2ug
Accessions: BC004954
Gene id: 6137
Gene description: ribosomal protein L13
Synonyms: BBC1; D16S444E; D16S44E; L13; 60S ribosomal protein L13; OK/SW-cl.46; breast basic conserved protein 1; ribosomal protein L13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcccagccggaatggcatggtcttgaagccccacttccacaaggactggcagcggcgcgtggccacgtggttcaaccagccggcccgtaagatccgcagacgtaaggcccggcaagccaaggcgcgccgcatcgccccgcgccccgcgtcgggtcccatccggcccatcgtgcgctgccccacggttcggtaccacacgaaggtgcgcgccggccgcggcttcagcctggaggagctcagggtggccggcattcacaagaaggtggcccggaccatcggcatttctgtggatccgaggaggcggaacaagtccacggagtccctgcaggccaacgtgcagcggctgaaggagtaccgctccaaactcatcctcttccccaggaagccctcggcccccaagaagggagacagttctgctgaagaactgaaactggccacccagctgaccggaccggtcatgcccgtccggaacgtctataagaaggagaaagctcgagtcatcactgaggaagagaagaatttcaaagccttcgctagtctccgtatggcccgtgccaacgcccggctcttcggcatacgggcaaaaagagccaaggaagccgcagaacaggatgttgaaaagaaaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD99 molecule-like 2
- germ cell associated 1
- distal-less homeobox 3
- SLAM family member 7

Reviews

Buy RPL13-ribosomal protein L13 Gene now

Add to cart