Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MAD2L1-MAD2 mitotic arrest deficient-like 1 (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAD2L1-MAD2 mitotic arrest deficient-like 1 (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000356 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAD2L1 |
| Origin species: | Human |
| Product name: | MAD2L1-MAD2 mitotic arrest deficient-like 1 (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC000356 |
| Gene id: | 4085 |
| Gene description: | MAD2 mitotic arrest deficient-like 1 (yeast) |
| Synonyms: | HSMAD2; mitotic spindle assembly checkpoint protein MAD2A; MAD2 (mitotic arrest deficient, yeast, homolog)-like 1; MAD2-like protein 1; mitotic arrest deficient 2-like protein 1; mitotic arrest deficient, yeast, homolog-like 1; MAD2 mitotic arrest deficient-like 1 (yeast) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgctgcagctctcccgggagcagggaatcaccctgcgcgggagcgccgaaatcgtggccgagttcttctcattcggcatcaacagcattttatatcagcgtggcatatatccatctgaaacctttactcgagtgcagaaatacggactcaccttgcttgtaactactgatcttgagctcataaaatacctaaataatgtggtggaacaactgaaagattggttatacaagtgttcagttcagaaactggttgtagttatctcaaatattgaaagtggtgaggtcctggaaagatggcagtttgatattgagtgtgacaagactgcaaaagatgacagtgcacccagagaaaagtctcagaaagctatccaggatgaaatccgttcagtgatcagacagatcacagctacggtgacatttctgccactgttggaagtttcttgttcatttgatctgctgatttatacagacaaagatttggttgtacctgaaaaatgggaagagtcgggaccacagtttattaccaattctgaggaagtccgccttcgttcatttactactacaatccacaaagtaaatagcatggtggcctacaaaattcctgtcaatgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger CCHC-type and RNA binding motif 1 - family with sequence similarity 60, member A - proprotein convertase subtilisin/kexin type 4 - small nuclear ribonucleoprotein polypeptide A |