> >>DLK2-delta-like 2 homolog (Drosophila) Gene
DLK2-delta-like 2 homolog (Drosophila) Gene View larger

DLK2-delta-like 2 homolog (Drosophila) Gene

PTXBC000230

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of DLK2-delta-like 2 homolog (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DLK2-delta-like 2 homolog (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000230
Product type: DNA & cDNA
Ncbi symbol: DLK2
Origin species: Human
Product name: DLK2-delta-like 2 homolog (Drosophila) Gene
Size: 2ug
Accessions: BC000230
Gene id: 65989
Gene description: delta-like 2 homolog (Drosophila)
Synonyms: DLK-2; EGFL9; protein delta homolog 2; EGF-like protein 9; EGF-like-domain, multiple 9; delta-like 2 homolog; epidermal growth factor-like protein 9; delta like non-canonical Notch ligand 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggccttgtgctaacggtgccacctgccttgacggcataaaccgcttctcctgcctctgtcctgagggctttgctggacgcttctgcaccatcaacctggatgactgtgccagccgcccatgccagagaggggcccgctgtcgggaccgtgtccacgacttcgactgcctctgccccagtggctatggtggcaagacctgtgagcttgtcttacctgtcccagaccccccaaccacagtggacacccctctagggcccacctcagctgtagtggtacctgccacggggccagccccccacagcgcaggggctggtctgctgcggatctcagtgaaggaggtggtgcggaggcaagaggctgggctaggtgagcctagcttggtggccctggtggtgtttggggccctcactgctgccctggttctggctactgtgttgctgaccctgagggcctggcgccggggtgtctgcccccctggaccctgttgctaccctgccccacactatgctccagcgtgccaggaccaggagtgtcaggttagcatgctgccagcagggctccccctgccacgtgacttgccccctgagcctggaaagaccacagcactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cell division cycle associated 4
- cell division cycle associated 3
- collectin sub-family member 11
- hypothetical protein MGC40574

Reviews

Buy DLK2-delta-like 2 homolog (Drosophila) Gene now

Add to cart