Cart 4 Product Products 469,80 € (empty)
-
1 x USH1G-Ushe...121,50 € -
1 x H3F3A-H3...113,40 € -
1 x SNX15-sort...121,50 € -
1 x PPP1R8-pro...113,40 €
No products
To be determined Shipping
469,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 469,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 469,80 €
View larger 
Data sheet of TM4SF4-transmembrane 4 L six family member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TM4SF4-transmembrane 4 L six family member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001386 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TM4SF4 |
| Origin species: | Human |
| Product name: | TM4SF4-transmembrane 4 L six family member 4 Gene |
| Size: | 2ug |
| Accessions: | BC001386 |
| Gene id: | 7104 |
| Gene description: | transmembrane 4 L six family member 4 |
| Synonyms: | ILTMP; il-TMP; transmembrane 4 L6 family member 4; intestinal and liver (il) tetraspan membrane protein; intestine and liver tetraspan membrane protein; transmembrane 4 superfamily member 4; transmembrane 4 L six family member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgcactgggggctgtgccagatgcctgggggggaccctcattccccttgctttttttggcttcctggctaacatcctgttattttttcctggaggaaaagtgatagatgacaacgaccacctttcccaagagatctggtttttcggaggaatattaggaagcggtgtcttgatgatcttccctgcgctggtgttcttgggcctgaagaacaatgactgctgtgggtgctgcggcaacgagggctgtgggaagcgatttgcgatgttcacctccacgatatttgctgtggttggattcttgggagctggatactcgtttatcatctcagccatttcaatcaacaagggtcctaaatgcctcatggccaatagtacatggggctaccccttccacgacggggattatctcaatgatgaggccttatggaacaagtgccgagagcctctcaatgtggttccctggaatctgaccctcttctccatcctgctggtcgtaggaggaatccagatggttctctgcgccatccaggtggtcaatggcctcctggggaccctctgtggggactgccagtgttgtggctgctgtgggggagatggacccgtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 12 open reading frame 49 - chromosome 6 open reading frame 223 - chromosome 1 open reading frame 163 - 3-hydroxybutyrate dehydrogenase, type 2 |