Cart 18 Product Products 3 175,91 € (empty)
-
-
1 x ZBP1-Z-DNA...113,40 € -
-
1 x Prolactin-...744,00 € -
1 x RSPO3-R-sp...121,50 € -
1 x Prolactin324,00 € -
1 x MAPKAP1-mi...121,50 € -
1 x RAB40AL-RA...121,50 € -
1 x C20orf141-...113,40 € -
1 x CABYR-calc...121,50 € -
1 x NXNL2-nucl...113,40 € -
-
1 x PAX3-paire...121,50 € -
-
1 x CSF2-colon...113,40 € -
1 x SLC35E2-so...121,50 € -
-
No products
To be determined Shipping
3 175,91 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 18 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 175,91 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 175,91 €
View larger 
ASF1B-ASF1 anti-silencing function 1 homolog B (S. cerevisiae) Gene
PTXBC007726
New product
Data sheet of ASF1B-ASF1 anti-silencing function 1 homolog B (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ASF1B-ASF1 anti-silencing function 1 homolog B (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007726 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ASF1B |
| Origin species: | Human |
| Product name: | ASF1B-ASF1 anti-silencing function 1 homolog B (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC007726 |
| Gene id: | 55723 |
| Gene description: | ASF1 anti-silencing function 1 homolog B (S. cerevisiae) |
| Synonyms: | histone chaperone ASF1B; CIA-II; ASF1 anti-silencing function 1 homolog B; CCG1-interacting factor A-II; anti-silencing function protein 1 homolog B; hAsf1; hAsf1b; hCIA-II; anti-silencing function 1B histone chaperone |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaaggtgtcggtgctgaacgtggcggtcctggagaacccgagccctttccacagccccttccggttcgagatcagcttcgagtgcagtgaagccctggcggacgacctggagtggaagatcatttatgttggctcggctgagagtgaggaatttgatcagatcctagactcggtgctggtgggccctgtgccagcagggagacacatgtttgtctttcaggccgacgcccccaacccatccctcatcccagagactgatgccgtgggtgtgactgtggtcctcatcacctgcacctaccatggacaggagttcatccgagtgggctactacgtcaacaacgagtacctcaaccctgagctgcgtgagaacccgcccatgaagccagatttctcccagctccagcggaacatcttggcctcgaacccccgggtgacccgcttccatatcaactgggacaacaacatggacaggctggaggccatagagacccaggacccctccctgggctgcggcctcccactcaactgcactcctatcaagggcttggggctccctggctgcatccctggcctcctccctgagaactccatggactgcatctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b - N-6 adenine-specific DNA methyltransferase 2 (putative) - cytochrome P450, family 19, subfamily A, polypeptide 1 - ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D |