Cart 53 Product Products 6 513,37 € (empty)
-
1 x ERMP1-endo...121,50 € -
1 x SLC38A5-so...121,50 € -
1 x THTPA-thia...113,40 € -
1 x CENPQ-cent...113,40 € -
1 x SFRS16-spl...113,40 € -
1 x C1orf52-ch...113,40 € -
1 x TNF-tumor...113,40 € -
1 x SDHALP2-su...113,40 € -
1 x TK1-thymid...113,40 € -
1 x PRSS22-pro...121,50 € -
1 x AGA-aspart...121,50 € -
1 x NKAPL-NFKB...121,50 € -
1 x STX17-synt...113,40 € -
-
1 x CMPK1-cyti...113,40 € -
1 x REEP5-rece...113,40 € -
1 x NCOA5-nucl...121,50 € -
1 x LPAR3-lyso...121,50 € -
-
-
1 x C15orf15-c...113,40 € -
1 x KDELR2-KDE...113,40 € -
1 x TNFRSF1B-t...121,50 € -
-
1 x C13orf16-c...113,40 € -
1 x SH2D4A-SH2...121,50 € -
1 x FAM108C1-f...121,50 € -
1 x C16orf14-c...113,40 € -
1 x GOLGA7-gol...113,40 € -
1 x HNRNPA1-he...121,50 € -
1 x FBXO32-F-b...113,40 € -
1 x HSF5-heat...121,50 € -
-
1 x HVCN1-hydr...121,50 € -
1 x FOXN2-fork...121,50 € -
1 x LRMP-lymph...121,50 € -
1 x RPS26-ribo...113,40 € -
1 x RPL39L-rib...113,40 € -
1 x C18orf10-c...113,40 € -
1 x C1orf21-ch...113,40 € -
1 x Phospho-Mc...259,07 € -
1 x FKBP1A-FK5...113,40 € -
1 x RFPL4B-ret...113,40 € -
1 x ASTL-astac...121,50 € -
1 x STX8-synta...113,40 € -
1 x MAGED4B-me...121,50 € -
1 x HP1BP3-het...113,40 € -
1 x SLC35F1-so...121,50 € -
-
1 x HNRNPK-het...121,50 € -
1 x TXNDC5-thi...121,50 € -
1 x COG8-compo...113,40 € -
1 x MAGEF1-mel...121,50 €
No products
To be determined Shipping
6 513,37 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 53 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 513,37 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 513,37 €
View larger 
Data sheet of DNAJC12-DnaJ (Hsp40) homolog, subfamily C, member 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJC12-DnaJ (Hsp40) homolog, subfamily C, member 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017018 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJC12 |
| Origin species: | Human |
| Product name: | DNAJC12-DnaJ (Hsp40) homolog, subfamily C, member 12 Gene |
| Size: | 2ug |
| Accessions: | BC017018 |
| Gene id: | 56521 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily C, member 12 |
| Synonyms: | dnaJ homolog subfamily C member 12; DnaJ (Hsp40) homolog, subfamily C, member 12; J domain containing protein 1 (JDP1); J domain protein 1; j domain-containing protein 1; DnaJ heat shock protein family (Hsp40) member C12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgcaatactgaattacaggtcagaagatactgaagattactacacattactgggatgtgatgaactatcttcggttgaacaaatcctggcagaatttaaagtcagagctctggaatgtcacccagacaagcatcctgaaaaccccaaagctgtggagacttttcagaaactgcagaaggcaaaggagattctgaccaatgaagagagtcgagcccgctatgaccactggcgaaggagccagatgtcgatgccattccagcagtgggaagctttgaatgactcagtgaagacgtcaatgcactgggttgtcagaggtaaaaaagacctgatgctggaagaatctgacaagactcataccaccaagatggaaaatgaggaatgtaatgagcaaagagaaagaaagaaagaggagctggcttcaaccgcagagaaaacggagcagaaagaacccaagcccctagagaagtcagtctccccgcaaaattcagattcttcaggttttgcagatgtgaatggttggcaccttcgtttccgctggtccaaggatgctccctcagaactcctgaggaagttcagaaactatgaaatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DiGeorge syndrome critical region gene 6-like - splicing factor, arginine/serine-rich 7, 35kDa - nicotinamide nucleotide adenylyltransferase 1 - DnaJ (Hsp40) homolog, subfamily C, member 28 |