RPL19-ribosomal protein L19 Gene View larger

RPL19-ribosomal protein L19 Gene

PTXBC000530

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL19-ribosomal protein L19 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL19-ribosomal protein L19 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000530
Product type: DNA & cDNA
Ncbi symbol: RPL19
Origin species: Human
Product name: RPL19-ribosomal protein L19 Gene
Size: 2ug
Accessions: BC000530
Gene id: 6143
Gene description: ribosomal protein L19
Synonyms: L19; 60S ribosomal protein L19; ribosomal protein L19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtatgctcaggcttcagaagaggctcgcctctagtgtcctccgctgtggcaagaagaaggtctggttagaccccaatgagaccaatgaaatcgccaatgccaactcccgtcagcagatccggaagctcatcaaagatgggctgatcatccgcaagcctgtgacggtccattcccgggctcgatgccggaaaaacaccttggcccgccggaagggcaggcacatgggcataggtaagcggaagggtacagccaatgcccgaatgccagagaaggtcacatggatgaggagaatgaggattttgcgccggctgctcagaagataccgtgaatctaagaagatcgatcgccacatgtatcacagcctgtacctgaaggtgaaggggaatgtgttcaaaaacaagcggattctcatggaacacatccacaagctgaaggcagacaaggcccgcaagaagctcctggctgaccaggctgaggcccgcaggtctaagaccaaggaagcacgcaagcgccgtgaagagcgcctccaggccaagaaggaggagatcatcaagactttatccaaggaggaagagaccaagaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L13
- CD99 molecule-like 2
- germ cell associated 1
- distal-less homeobox 3

Reviews

Buy RPL19-ribosomal protein L19 Gene now

Add to cart