Cart 40 Product Products 5 704,80 € (empty)
-
1 x C-Reactive...544,00 € -
1 x M6PR-manno...121,50 € -
-
1 x SPANXE-SPA...113,40 € -
1 x ARC-activi...121,50 € -
1 x SMCP-sperm...113,40 € -
-
1 x TM4SF18-tr...113,40 € -
1 x GC-group-s...121,50 € -
1 x NEU4-siali...121,50 € -
1 x TMEM31-tra...113,40 € -
1 x PLA2G2D-ph...113,40 € -
1 x C20orf177-...121,50 € -
1 x WDR53-WD...121,50 € -
1 x CCL22-chem...113,40 € -
1 x PRRG4-prol...113,40 € -
1 x MGC87631-s...113,40 € -
-
-
1 x POLB-polym...121,50 € -
1 x ANXA8-anne...121,50 € -
-
-
1 x ATPAF2-ATP...121,50 € -
1 x HTR2B-5-hy...121,50 € -
1 x GSTK1-glut...113,40 € -
-
1 x TMEM55A-tr...113,40 € -
1 x ORAI1-ORAI...113,40 € -
-
1 x ASB7-ankyr...121,50 € -
-
1 x WFDC9-WAP...113,40 € -
-
-
-
1 x CCNL1-cycl...113,40 € -
1 x UBE2T-ubiq...113,40 € -
-
No products
To be determined Shipping
5 704,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 40 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 704,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 704,80 €
Data sheet of AK1-adenylate kinase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AK1-adenylate kinase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001116 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AK1 |
| Origin species: | Human |
| Product name: | AK1-adenylate kinase 1 Gene |
| Size: | 2ug |
| Accessions: | BC001116 |
| Gene id: | 203 |
| Gene description: | adenylate kinase 1 |
| Synonyms: | HTL-S-58j; adenylate kinase isoenzyme 1; ATP-AMP transphosphorylase 1; ATP:AMP phosphotransferase; adenylate monophosphate kinase; myokinase; testis secretory sperm binding protein Li 58j; adenylate kinase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagagaagctgaagaaaaccaatatcatctttgtggtgggtgggcctggctcagggaagggcacccagtgtgagaagatcgtgcagaagtatggctacacccacctctccaccggggacctcctgcggtccgaggtcagctcaggctcggccaggggcaagaagctgtcggaaatcatggagaaggggcagctggttccactggagacagtgttggacatgctccgggatgccatggtggccaaagtcaatacttccaaaggcttcctgattgatggctacccgcgggaggtgcagcaaggagaagagtttgagcgacggattggacagcccacactgctgctgtatgtggacgcaggccctgagaccatgacccagcggctcttgaaacgtggagagaccagcgggcgtgtggacgacaatgaggagaccatcaaaaagcggctggagacctattacaaggccacagaacccgtcatcgccttctatgagaaacgtggcattgtgcgcaaggtcaacgctgagggctccgtggacagtgtcttctcccaggtctgcacccacctggacgccctaaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosducin-like 2 - sorting nexin 11 - Obg-like ATPase 1 - CD300a molecule |