> >>MRPL11-mitochondrial ribosomal protein L11 Gene
MRPL11-mitochondrial ribosomal protein L11 Gene View larger

MRPL11-mitochondrial ribosomal protein L11 Gene

PTXBC005002

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of MRPL11-mitochondrial ribosomal protein L11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL11-mitochondrial ribosomal protein L11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005002
Product type: DNA & cDNA
Ncbi symbol: MRPL11
Origin species: Human
Product name: MRPL11-mitochondrial ribosomal protein L11 Gene
Size: 2ug
Accessions: BC005002
Gene id: 65003
Gene description: mitochondrial ribosomal protein L11
Synonyms: CGI-113; L11MT; MRP-L11; 39S ribosomal protein L11, mitochondrial; mitochondrial ribosomal protein L11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcaaagctcggccgggccgcccggggcctcaggaagcccgaggtcggcggtgtaatccgggcgatcgtgcgggcaggcctggccatgcccgggcccccactaggcccagtgctgggtcagagaggcgtttccatcaaccagttttgcaaggagttcaatgagaggacaaaggacatcaaggaaggcattcctctgcctaccaagattttagtgaagcctgacaggacatttgaaattaagattggacagcccactgtttcctacttcctgaaggcagcagctgggattgaaaagggggcccggcaaacagggaaagaggtggcaggcctggtgaccttgaagcatgtgtatgagattgcccgcatcaaagctcaggatgaggcatttgccctgcaggatgtacccctgtcgtctgttgtccgctccatcatcgggtctgcccgttctctgggcattcgcgtggtgaaggacctcagttcagaagagcttgcagctttccagaaggaacgagccatcttcctggctgctcagaaggaggcagatttggctgcccaagaagaagctgccaagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 95
- chromosome 1 open reading frame 83
- golgi SNAP receptor complex member 2
- mitochondrial ribosomal protein S35

Reviews

Buy MRPL11-mitochondrial ribosomal protein L11 Gene now

Add to cart