SEC11C-SEC11 homolog C (S. cerevisiae) Gene View larger

SEC11C-SEC11 homolog C (S. cerevisiae) Gene

PTXBC009703

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SEC11C-SEC11 homolog C (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SEC11C-SEC11 homolog C (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009703
Product type: DNA & cDNA
Ncbi symbol: SEC11C
Origin species: Human
Product name: SEC11C-SEC11 homolog C (S. cerevisiae) Gene
Size: 2ug
Accessions: BC009703
Gene id: 90701
Gene description: SEC11 homolog C (S. cerevisiae)
Synonyms: signal peptidase complex catalytic subunit SEC11C; SEC11L3; SPC21; SPCS4C; SEC11 homolog C; SEC11-like 3; SEC11-like protein 3; SPase 21 kDa subunit; microsomal signal peptidase 21 kDa subunit; signal peptidase complex 21; SEC11 homolog C, signal peptidase complex subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcgtgcgggcgccgtgggggctcatctccccgcgtccggcttggatatcttcggggacctgaagaagatgaacaagcgccagctctattaccaggttttaaacttcgccatgatcgtgtcttctgcactcatgatatggaaaggcttgatcgtgctcacaggcagtgagagccccatcgtggtggtgctgagtggcagtatggagccggcctttcacagaggagacctcctgttcctcacaaatttccgggaagacccaatcagagctggtgaaatagttgtttttaaagttgaaggacgagacattccaatagttcacagagtaatcaaagttcatgaaaaagataatggagacatcaaatttctgactaaaggagataataatgaagttgatgatagaggcttgtacaaagaaggccagaactggctggaaaagaaggacgtggtgggaagagcaagagggtttttaccatatgttggtatggtcaccataataatgaatgactatccaaaattcaagtatgctcttttggctgtaatgggtgcatatgtgttactaaaacgtgaatcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ras homolog gene family, member A
- dual specificity phosphatase 14
- delta-like 2 homolog (Drosophila)
- cell division cycle associated 4

Reviews

Buy SEC11C-SEC11 homolog C (S. cerevisiae) Gene now

Add to cart